Schema for Indels(93) - Indels for 93 wheat accessions
  Database: wheat_V2    Primary Table: Indels Data last updated: 2020-08-08
Big Bed File: /gbdb/wheat_V2/snp/Indel.bb
Item Count: 1,016,517
Format description: Indels for wheat
fieldexampledescription
chrom1AReference sequence chromosome or scaffold
chromStart396099701Start position in chromosome
chromEnd396099702End position in chromosome
name1A:396099702Indel postion
alleleCG/CAllele
MAF0.098Minor allele frequencies
sampleNumber87Effective sample size
consequenceTypeupstream_gene_variantConsequenceType
geneSymbolTraesCS1A02G225600Gene Symbol

Sample Rows
 
chromchromStartchromEndnamealleleMAFsampleNumberconsequenceTypegeneSymbol
1A3960997013960997021A:396099702CG/C0.09887upstream_gene_variantTraesCS1A02G225600
1A3961002673961002681A:396100268AT/A0.02387upstream_gene_variantTraesCS1A02G225600
1A3961049333961049341A:396104934GTACATGGATATTTTTCTGCT/G0.18086upstream_gene_variantTraesCS1A02G225700
1A3961051333961051341A:396105134C/CA0.05886splice_region_variantTraesCS1A02G225700
1A3961061303961061311A:396106131A/AGG0.02482downstream_gene_variantTraesCS1A02G225600
1A3961068703961068711A:396106871C/CAT0.06987downstream_gene_variantTraesCS1A02G225600
1A3961082283961082291A:396108229AACCAGCTG/A0.03488upstream_gene_variantTraesCS1A02G225700
1A3961089493961089501A:396108950CTAGTTA/C0.10581upstream_gene_variantTraesCS1A02G225700
1A3961094023961094031A:396109403CT/C0.02387upstream_gene_variantTraesCS1A02G225700
1A3962611683962611691A:396261169C/CA0.02987upstream_gene_variantTraesCS1A02G225800