Multiz alignments of 78 ruminants and 32 outgroup species
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 5 in window, 93661455 - 93661456, 2 bps 
B D                     ARS1  tc
                      Rabbit  tc
                 BelugaWhale  tc
                         Pig  tc
                       Horse  tc
             ChinesePangolin  tc
                   BlueWhale  tc
     CommonBottlenoseDolphin  tc
              FloridaManatee  tc
                       Human  tc
                    Aardvark  tc
         GreaterHorseshoeBat  tc
                      Alpaca  tc
           WildBactrianCamel  tc
                ArabianCamel  tc
                         Dog  tc
                  HouseMouse  tt
            ChineseTreeShrew  tc
                  MinkeWhale  tc
                 KillerWhale  tc
                  SpermWhale  tc
              ChacoanPeccary  cc

Alignment block 2 of 5 in window, 93661455 - 93661456, 2 bps 
B D                   ARS1  tc
             AmericanBison  tc
                ZebuCattle  tc
                      Gaur  tc
               DomesticYak  tc
            AfricanBuffalo  tc
                    Lechwe  tc
                   Gemsbok  tc
        ScimitarHornedOryx  tc
              RoanAntelope  tc
             SableAntelope  tc
                    Herola  tc
                   RedDeer  tc
                   HogDeer  tc
            PereDavidsDeer  tc
               YarkandDeer  tc
              MountainGoat  tc
           EuropeanMouflon  tc
                 SnowSheep  tc
              BighornSheep  tc
                     Sheep  tc
            AsiaticMouflon  tc
              BarbarySheep  tc
                    Bharal  tc
               NilgiriTahr  tc
                  WildGoat  tc
              SiberianIbex  tc
             ReevesMuntjac  tc
           WhiteTailedDeer  tc
                  MuleDeer  tc
                  Reindeer  tc
            EasternRoeDeer  tc
               EurasianElk  tc
          ChineseWaterDeer  tc
                   Giraffe  tc
                 Pronghorn  tc
           TibetanAntelope  tc
            BlueWildebeest  tc
                      Topi  tc
             BohorReedbuck  tc
          DefassaWaterbuck  tc
              Klipspringer  tc
             RoyalAntelope  tc
             HarveysDuiker  tc
              CommonDuiker  tc
            MaxwellsDuiker  tc
               KirksDikDik  tc
                  Steenbok  tc
        PrzewalskisGazelle  tc
                     Oribi  tc
           ThomsonsGazelle  tc
             GrantsGazelle  tc
                   Gerenuk  tc
                 Springbok  tc
                      Suni  tc
                    Impala  tc
                  Bushbuck  tc
               GreaterKudu  tc
               CommonEland  tc
     ChineseForestMuskDeer  tc
              BlackMuntjac  tc
           WhiteLippedDeer  tc
                    Cattle  tc
              WaterBuffalo  tc
             MountainNyala  tc
                     Bongo  cc
          SiberianMuskDeer  tc
            WesternRoeDeer  tc
                     Gayal  tc
                 Sitatunga  tc
           LesserMouseDeer  tt
                     Saiga  tc
            AlpineMuskDeer  tc
                     Okapi  tc
             JavaMouseDeer  tt
                LesserKudu  tc
             IndianMuntjac  tc

Alignment block 3 of 5 in window, 93661457 - 93661464, 8 bps 
B D                   ARS1  tttccaga
             AmericanBison  tttccaga
                ZebuCattle  tttccaga
                      Gaur  tttccaga
               DomesticYak  tttccaga
            AfricanBuffalo  tttccaga
                    Lechwe  tttccaga
                   Gemsbok  tttccaga
        ScimitarHornedOryx  tttccaga
              RoanAntelope  tttccaga
             SableAntelope  tttccaga
                    Herola  tttccaga
                   RedDeer  tttccaga
                   HogDeer  tttccaga
            PereDavidsDeer  tttccaga
               YarkandDeer  tttccaga
              MountainGoat  tttccaga
           EuropeanMouflon  tttccaga
                 SnowSheep  tttccaga
              BighornSheep  tttccaga
                     Sheep  tttccaga
            AsiaticMouflon  tttccaga
              BarbarySheep  tttccaga
                    Bharal  tttccaga
               NilgiriTahr  tttccaga
                  WildGoat  tttccaga
              SiberianIbex  tttccaga
             ReevesMuntjac  tttccaga
           WhiteTailedDeer  tttccaga
                  MuleDeer  tttccaga
                  Reindeer  tttccaga
            EasternRoeDeer  tttgcaga
               EurasianElk  tttccaga
          ChineseWaterDeer  tttgcaga
                   Giraffe  tttccaga
                 Pronghorn  tttccaga
           TibetanAntelope  tttccaga
            BlueWildebeest  tttccaga
                      Topi  tttccaga
             BohorReedbuck  tttccaga
          DefassaWaterbuck  tttccaga
              Klipspringer  tttccaga
             RoyalAntelope  tttccaga
             HarveysDuiker  tttccaga
              CommonDuiker  tttccaga
            MaxwellsDuiker  tttccaga
               KirksDikDik  tttccaga
                  Steenbok  tttccaga
        PrzewalskisGazelle  tttccaga
                     Oribi  tttccaga
           ThomsonsGazelle  tttccaga
             GrantsGazelle  tttccaga
                   Gerenuk  tttccaga
                 Springbok  tttccaga
                      Suni  ttttcaga
                    Impala  tttgcaga
                  Bushbuck  tttccaga
               GreaterKudu  tttccaga
               CommonEland  tttccaga
     ChineseForestMuskDeer  tttccaga
              BlackMuntjac  tttccaga
           WhiteLippedDeer  tttccaga
                    Cattle  tttccaga
              WaterBuffalo  tttccaga
             MountainNyala  tttccaga
                     Bongo  tttccaga
          SiberianMuskDeer  tttccaga
            WesternRoeDeer  tttgcaga
                     Gayal  tttccaga
                 Sitatunga  tttccaga
           LesserMouseDeer  tttccaga
                     Saiga  tttccaga
            AlpineMuskDeer  tttccaga
                     Okapi  tttccaga
             JavaMouseDeer  tttccaga
                LesserKudu  tttccaga
             IndianMuntjac  tttccaga

Alignment block 4 of 5 in window, 93661457 - 93661565, 109 bps 
B D                     ARS1  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgct
              GreenSeaTurtle  ttttcagattttagctatgattgaagaagcagctggtacgaggatgtatgagtgcaagaaaatagctgcc
         GreaterHorseshoeBat  tctctagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
     WesternEuropeanHedgehog  attccagattttatccatgatcgaagaagcagctggaacaaggatgtatgaatacaaaaaaatagctgct
                  RockPigeon  tttttagattttagctatggttgaagaagcagctggtactaggatgtatgaatgcaagaaattaactgcc
                      Alpaca  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaagatagctgcc
           WildBactrianCamel  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaagatagctgcc
                ArabianCamel  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaagatagctgcc
                         Dog  tttctagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
                  HouseMouse  attccagatattatccatgattgaagaagctgctggaaccaggatgtatgagtacaaaaaaatagccgcc
            ChineseTreeShrew  attccagattttatccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaattagctgct
                  MinkeWhale  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
                 KillerWhale  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaagatagctgcc
                  SpermWhale  tttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatataaaaagatagctgcc
              ChacoanPeccary  tttacagattttgtccatgatagaagaagcagctggaactaggatgtatgaatacaaaaaaattgctgcc
                MonkParakeet  -ttttagattttagctatgattgaagaagcagctggtacaaggttgtatgaaagcaagaaattaactgtc
B                    chicken  -ttttagattctagctatgattgaagaagcagctggtactaggatgtatgaatgcaagaaaataactgcc
                    Aardvark  -ttgcagattttatctatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
                       Human  -ttccagattttatccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgca
                     Tuatara  -tttcagattttagctatgattgaagaagcagctggtaccagaatgtatgaatgcaagaaaatagctgca
              FloridaManatee  -tttcagattttatctatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
     CommonBottlenoseDolphin  -ttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaggtagctgcc
                   BlueWhale  -ttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
B                  zebrafish  -ttttagattttggccatgattgaggaggcagcaggtacaaggatgtacgaatgtaagaagatcagtgct
                       Horse  -ttgcagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
                         Pig  -ttacagattttgtccatgatagaagaagcagctggaactaggatgtatgaatacaaaaaaatagctgcc
                 BelugaWhale  -ttccagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaagatagctgcc
                      Rabbit  -tttcagattttatccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc
                  SeaLamprey  ---ccagatcctggcgatgattgaggaggctgcggggaccaggatgtacgagagtaagaaactggcagcg
                  Coelacanth  ----cagattttggcgatgattgaagaagcagctggaaccaggatgtacgagtgcaagaagattgctgct
          TropicalClawedFrog  ----cagattctagctatgattgaagaagcagctggtacaaggatgtatgaatgcaagaaaattgctgct
             ChinesePangolin  ----tagattttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaaatagctgcc

                        ARS1  cagaggactatagaaaaaaaggaggctaagctgagagaa
              GreenSeaTurtle  cagaaaactatagagaaaaaagaggcaaaactgaaagaa
         GreaterHorseshoeBat  cagaaaactataggaaaaaaggaggctaagctgaaagaa
     WesternEuropeanHedgehog  cagaaaaccatagaaaaaaaggaggccaaactgaaagaa
                  RockPigeon  cagaaaaccatagagaagaaagaatccaaactcgaaaac
                      Alpaca  cagaagactatagaaaaaaaggaggctaagctgaaagag
           WildBactrianCamel  cagaagactatagaaaaaaaggaggctaagctgaaagag
                ArabianCamel  cagaagactatagaaaaaaaggaggctaagctgaaagag
                         Dog  cagaaaactatagaaaaaaaagaggctaagctgaaagaa
                  HouseMouse  cagaaaactatagaaaaaaaggaggctaagctgaaagaa
            ChineseTreeShrew  caaaaaactatagagaaaaaagaggctaagctaaaagaa
                  MinkeWhale  cagaagactatagagaaaaaggaggctaagctgaaagaa
                 KillerWhale  cagaagactatagaaaaaaaggaggctaagctgaaagaa
                  SpermWhale  cagaagactatagaaaaaaaggaggctaagctgaaagaa
              ChacoanPeccary  cagaagactatagaaaaaaaggaggctaagttgaaagaa
                MonkParakeet  cagaaaaccatagtgaagaaagaagccaaactgaaagaa
                     chicken  cataagaccatagaaaagaaggaaagcaaactggatgaa
                    Aardvark  cagaaaactatagaaaaaaaggaggctaagctgaaagaa
                       Human  cagaaaactatagaaaaaaaggaggctaagctgaaagaa
                     Tuatara  cagaaaaccatagagaaaaaagaggcaaagctgaaagaa
              FloridaManatee  cagaaaactatagaaaaaaaggaggctaagctgaaagaa
     CommonBottlenoseDolphin  cagaagactatagaaaaaaaggaggctaagctgaaagaa
                   BlueWhale  cagaagactatagaaaaaaaggaggctaagctgaaagaa
                   zebrafish  cagaaaactattgagaagaaagatgctaagctcaaagaa
                       Horse  cagaaaactatagaaaaaaaggaggctaagctcaaagaa
                         Pig  cagaagacaatagagaaaaaggaggctaagctaaaagaa
                 BelugaWhale  cagaagactatagaaaaaaaggaggctaagctgaaagaa
                      Rabbit  cagaaaactatagaaaaaaaggaggctaagctgaaagaa
                  SeaLamprey  cagaagactattgagaagaaagaggccaaacttaaggag
                  Coelacanth  cagaaaacgatagaaaagaaggaggcgaaactgaaagag
          TropicalClawedFrog  caaaaaactattgagaaaaaggaagccaagctcaaagaa
             ChinesePangolin  cagaaaactatagaaaaaaaggaggctaagctgaaagaa

Alignment block 5 of 5 in window, 93661465 - 93661565, 101 bps 
B D                   ARS1  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             AmericanBison  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                ZebuCattle  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                      Gaur  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
               DomesticYak  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            AfricanBuffalo  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                    Lechwe  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                   Gemsbok  ttttgtctatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
        ScimitarHornedOryx  ttttgtctatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              RoanAntelope  ttttgtctatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             SableAntelope  ttttgtctatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                    Herola  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                   RedDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                   HogDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            PereDavidsDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
               YarkandDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              MountainGoat  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
           EuropeanMouflon  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                 SnowSheep  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaagaaacaaaatgctcagaggac
              BighornSheep  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                     Sheep  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            AsiaticMouflon  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              BarbarySheep  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                    Bharal  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
               NilgiriTahr  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                  WildGoat  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              SiberianIbex  ttttgtccatgatagaagaagcagcaggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             ReevesMuntjac  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
           WhiteTailedDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                  MuleDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                  Reindeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            EasternRoeDeer  ttctgtccatgatagaagaagccgctggaaccaggatgtatgagtacaaaaagcagaatgctcagaggac
               EurasianElk  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
          ChineseWaterDeer  ttctgtccatgatagaagaagcagctggaaccaggatgtatgagtacaaaaagcagaatgctcagaggac
                   Giraffe  ttttgtccatgatagaagaagcagctggaacgaggatgtatgaatacaaaaaacaaaatgctcagaggac
                 Pronghorn  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
           TibetanAntelope  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            BlueWildebeest  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                      Topi  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             BohorReedbuck  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
          DefassaWaterbuck  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              Klipspringer  ttttgtccatgatagaagaagcagctggtaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             RoyalAntelope  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             HarveysDuiker  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              CommonDuiker  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            MaxwellsDuiker  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
               KirksDikDik  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                  Steenbok  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
        PrzewalskisGazelle  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                     Oribi  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
           ThomsonsGazelle  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             GrantsGazelle  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                   Gerenuk  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                 Springbok  ttttgtccatgatagaggaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                      Suni  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                    Impala  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                  Bushbuck  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
               GreaterKudu  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
               CommonEland  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
     ChineseForestMuskDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              BlackMuntjac  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
           WhiteLippedDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                    Cattle  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
              WaterBuffalo  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaagaaacaaaatgctcagaggac
             MountainNyala  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                     Bongo  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
          SiberianMuskDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            WesternRoeDeer  ttctgtccatgatagaagaagccgctggaaccaggatgtatgagtacaaaaagcagaacgctcagaggac
                     Gayal  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                 Sitatunga  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
           LesserMouseDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgcccagaggac
                     Saiga  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
            AlpineMuskDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
                     Okapi  ttttgtccatgatagaagaagcagctggaacgaggatgtatgaatacaaaaaacaaaatgctcagaggac
             JavaMouseDeer  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgcccagaggac
                LesserKudu  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac
             IndianMuntjac  ttttgtccatgatagaagaagcagctggaaccaggatgtatgaatacaaaaaacaaaatgctcagaggac

                      ARS1  tatagaaaaaaaggaggctaagctgagagaa
             AmericanBison  tatagaaaaaaaggaggctaagctgagagaa
                ZebuCattle  tatagaaaaaaaggaggctaagctgagagaa
                      Gaur  tatagaaaaaaaggaggctaagctgagagaa
               DomesticYak  tatagaaaaaaaggaagctaagctgagagaa
            AfricanBuffalo  tatagaaaaaaaggaggctaagctgagagaa
                    Lechwe  tatagaaaaaaaggaggctaagctgaaagaa
                   Gemsbok  tatagaaaaaaaggaggctaagctgagagaa
        ScimitarHornedOryx  tatagaaaaaaaggaggctaagctgagagaa
              RoanAntelope  tatagaaaaaaaggaggctaagctgagagaa
             SableAntelope  tatagaaaaaaaggaggctaagctgagagaa
                    Herola  tatagaaaaaaaggaggctaagctgagagaa
                   RedDeer  tatagaaaaaaaggaggctaagctgagagaa
                   HogDeer  tatagaaaaaaaggaggctaagctgagagaa
            PereDavidsDeer  tatagaaaaaaaggaggctaagctgagagaa
               YarkandDeer  tatagaaaaaaaggaggctaagctgagagaa
              MountainGoat  tatagaaaaaaaggaggctaagctgagagaa
           EuropeanMouflon  tatagaaaaaaaggaggctaagctgagagaa
                 SnowSheep  tatagaaaaaaaggaggctaagctgagagaa
              BighornSheep  tatagaaaaaaaggaggctaagctgagagaa
                     Sheep  tatagaaaaaaaggaggctaagctgagagaa
            AsiaticMouflon  tatagaaaaaaaggaggctaagctgagagaa
              BarbarySheep  tatagaaaaaaaggaggctaagctgagagaa
                    Bharal  tatagaaaaaaaggaggctaagctgagagaa
               NilgiriTahr  tatagaaaaaaaggaggctaagctgagagaa
                  WildGoat  tatagaaaaaaaggaggctaagctgagagaa
              SiberianIbex  tatagaaaaaaaggaggctaagctgagagaa
             ReevesMuntjac  gatagaaaaaaaggaggctaagctgagagaa
           WhiteTailedDeer  tatagaaaaaaaggaggctaagctgagagaa
                  MuleDeer  tatagaaaaaaaggaggctaagctgagagaa
                  Reindeer  tatagaaaaaaaggaggctaagctgagagaa
            EasternRoeDeer  catagaaaaaaaggaggctaagctgagagag
               EurasianElk  tatagaaaaaaaggaggctaagctgagagaa
          ChineseWaterDeer  tatagaaaaaaaggaggctaagctgagagag
                   Giraffe  tatagaaaaaaaggaggctaagctgagagaa
                 Pronghorn  tatagaaaaaaaggaggctaaactgagagaa
           TibetanAntelope  tatagaaaaaaaggaggctaagctgagagaa
            BlueWildebeest  tatagaaaaaaaggaggctaagctgagagaa
                      Topi  tatagaaaaaaaggaggctaagctgagagaa
             BohorReedbuck  tatagaaaaaaaggaggctaagctgaaagaa
          DefassaWaterbuck  tatagaaaaaaaggaggctaagctgaaagaa
              Klipspringer  tatagaaaaaaaggaggctaagctgagagaa
             RoyalAntelope  tatagaaaaaaaggaggctaagctgagagaa
             HarveysDuiker  tatagaaaaaaaggaggctaagctgagagaa
              CommonDuiker  tatagaaaaaaaggaggctaagctgagagaa
            MaxwellsDuiker  tatagaaaaaaaggaggctaagctaagagaa
               KirksDikDik  tatagagaaaaaggaggctaagctgagagaa
                  Steenbok  tatagaaaaaaaggaggctaagctgagggaa
        PrzewalskisGazelle  tatagaaaaaaaggaggctaagctgagagaa
                     Oribi  tatagaaaaaaaggaggctaagctgagagaa
           ThomsonsGazelle  tatagaaaaaaaggaggctaagctgaaagaa
             GrantsGazelle  tatagaaaaaaaggaggctaagctgagagaa
                   Gerenuk  tatagaaaaaaaggaggctaagctgagagaa
                 Springbok  tatagaaaaaaaggaggctaagctgagagaa
                      Suni  tatagaaaaaaaagaggctaagctgagagaa
                    Impala  tatagaaaaaaaggaggctaagctgagagaa
                  Bushbuck  tatagaaaaaaaggaggctaagctgagagaa
               GreaterKudu  tatagaaaaaaaggaggctaagctgagagaa
               CommonEland  tatagaaaaaaaggaggctaagctgagagaa
     ChineseForestMuskDeer  tatagaaaaaaaggaggctaagctgagagaa
              BlackMuntjac  gatagaaaaaaaggaggctaagctgagagaa
           WhiteLippedDeer  tatagaaaaaaaggaggctaagctgagagaa
                    Cattle  tatagaaaaaaaggaggctaagctgagagaa
              WaterBuffalo  tatagaaaaaaaggaggctaagctgagagaa
             MountainNyala  tatagaaaaaaaggaggctaagctgagagaa
                     Bongo  tatagaaaaaaaggaggctaagctgagagaa
          SiberianMuskDeer  tatagaaaaaaaggaggctaagctgagagaa
            WesternRoeDeer  catagaaaaaaaggaggctaagctgagagag
                     Gayal  tatagaaaaaaaggaggctaagctgagagaa
                 Sitatunga  tatagaaaaaaaggaggctaagctgagagaa
           LesserMouseDeer  tatagaaaaaaaggaggctaagctgaaagaa
                     Saiga  tatagaaaaaaaggaggctaagctgagagaa
            AlpineMuskDeer  tatagaaaaaaaggaggctaagctgagagaa
                     Okapi  tatagaaaaaaaggaggctaagctgagagaa
             JavaMouseDeer  tatagaaaaaaaggaggctaagctgaaagaa
                LesserKudu  tatagaaaaaaaggaggctaagctgagagaa
             IndianMuntjac  gatagaaaaaaaggaggctaagctgagagaa

View table schema

Go to 110-way Multiz Align track controls

Data last updated: 2021-07-30