Multiz alignments of 78 ruminants and 32 outgroup species
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 177 in window, 129059547 - 129059627, 81 bps 
B D  Oar_rambouillet_v1_0_addY  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 JavaMouseDeer  agccaatcatagctcctgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                         Bongo  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                         Saiga  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                         Gayal  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                    LesserKudu  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                     Sitatunga  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 MountainNyala  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
               LesserMouseDeer  agccaatcatagctcctgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                AlpineMuskDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                WesternRoeDeer  agccaatcacaggtcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                          Gaur  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 AmericanBison  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                       WildYak  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   DomesticYak  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  WaterBuffalo  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                AfricanBuffalo  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   CommonEland  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   GreaterKudu  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                      Bushbuck  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                        Impala  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                          Suni  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  Klipspringer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 RoyalAntelope  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   KirksDikDik  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
            PrzewalskisGazelle  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                         Oribi  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
               ThomsonsGazelle  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                       Gerenuk  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                     Springbok  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                MaxwellsDuiker  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 HarveysDuiker  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 BohorReedbuck  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
              DefassaWaterbuck  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                        Lechwe  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                       Gemsbok  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
            ScimitarHornedOryx  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  RoanAntelope  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 SableAntelope  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                BlueWildebeest  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                          Topi  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                        Herola  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
               TibetanAntelope  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  MountainGoat  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
               EuropeanMouflon  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                AsiaticMouflon  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                     SnowSheep  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  BighornSheep  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  BarbarySheep  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                        Bharal  agccaatcacagatccggacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   NilgiriTahr  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
B D                       ARS1  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                      WildGoat  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  SiberianIbex  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
         ChineseForestMuskDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                  BlackMuntjac  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccacttggaatnnnnn
                 IndianMuntjac  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                 ReevesMuntjac  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                PereDavidsDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
               WhiteLippedDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   YarkandDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                       RedDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                       HogDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
               WhiteTailedDeer  aaccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                      MuleDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                      Reindeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                EasternRoeDeer  agccaatcacaggtcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                   EurasianElk  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
              ChineseWaterDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                       Giraffe  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                     Pronghorn  agccaatcacaggtcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                        Cattle  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                    ZebuCattle  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
              SiberianMuskDeer  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------
                         Okapi  agccaatcacagatcccgacgacacttgtctcatcaaagttggaatataaaaagccac------------

     Oar_rambouillet_v1_0_addY  -----ttggaatacagtat-aaaagattc
                 JavaMouseDeer  -----ttggaatacagtag-aaaagattg
                         Bongo  -----ttggaatacagtat-aaaagattc
                         Saiga  -----ttggaatacagtat-aaaagattc
                         Gayal  -----ttggaatacagtat-aaaagattc
                    LesserKudu  -----ttggaatacagtat-aaaagattc
                     Sitatunga  -----ttggaatacagtat-aaaagattc
                 MountainNyala  -----ttggaatacagtat-aaaagattc
               LesserMouseDeer  -----ttggaatacagtag-aaaagattg
                AlpineMuskDeer  -----ttggaatacagtat-aaaagattc
                WesternRoeDeer  -----ttggaatacagtat-aaaagattc
                          Gaur  -----ttggaatacagtat-aaaagattc
                 AmericanBison  -----ttggaatacagtat-aaaagattc
                       WildYak  -----ttggaatacagtat-aaaagattc
                   DomesticYak  -----ttggaatacagtat-aaaagattc
                  WaterBuffalo  -----ttggaatacagtat-aaaagattc
                AfricanBuffalo  -----ttggaatacagtat-aaaagattc
                   CommonEland  -----ttggaatacagtat-aaaagattc
                   GreaterKudu  -----ttggaatacagtat-aaaagattc
                      Bushbuck  -----ttggaatacagtat-aaaagattc
                        Impala  -----ttggaatacagtat-aaaagattc
                          Suni  -----ttggaatacagtat-aaaagattc
                  Klipspringer  -----ttggaatacagtat-aaaagattc
                 RoyalAntelope  -----ttggaatacagtat-aaaagattc
                   KirksDikDik  -----ttggaatacagtat-aaaagattc
            PrzewalskisGazelle  -----ttggaatacagtat-aaaagattc
                         Oribi  -----ttggaatacagtat-aaaagattc
               ThomsonsGazelle  -----ttggaatacagtat-aaaagattc
                       Gerenuk  -----ttggaatacagtat-aaaagattc
                     Springbok  -----ttggaatacagtat-aaaagattc
                MaxwellsDuiker  -----ttggaatacagtat-aaaagattc
                 HarveysDuiker  -----ttggaatacagtat-aaaagattc
                 BohorReedbuck  -----ttggaatacagtat-aaaagattc
              DefassaWaterbuck  -----ttggaatacagtat-aaaagattc
                        Lechwe  -----ttggaatacagtat-acaagattc
                       Gemsbok  -----ttggaatacagtat-aaaagattc
            ScimitarHornedOryx  -----ttggaatacagtat-aaaagattc
                  RoanAntelope  -----ttggaatacagtat-aaaagattc
                 SableAntelope  -----ttggaatacagtat-aaaagattc
                BlueWildebeest  -----ttggaatacagtat-aaaagattc
                          Topi  -----ttggaatacagtat-aaaagattc
                        Herola  -----ttggaatacagtat-aaaagattc
               TibetanAntelope  -----ttggaatacagtat-aaaagattc
                  MountainGoat  -----ttggaatacagtat-aaaagattc
               EuropeanMouflon  -----ttggaatacagtat-aaaagattc
                AsiaticMouflon  -----ttggaatacagtat-aaaagattc
                     SnowSheep  -----ttggaatacagtat-aaaagattc
                  BighornSheep  -----ttggaatacagtat-aaaagattc
                  BarbarySheep  -----ttggaatacagtat-aaaagattc
                        Bharal  -----ttggaatacagtat-aaaagattc
                   NilgiriTahr  -----ttggaatacagtat-aaaagattc
                          ARS1  -----ttggaatacagtat-aaaagattc
                      WildGoat  -----ttggaatacagtat-aaaagattc
                  SiberianIbex  -----ttggaatacagtat-aaaagattc
         ChineseForestMuskDeer  -----ttggaatacagtat-aaaagattc
                  BlackMuntjac  nnnnnttggaatacagtataaaaagattc
                 IndianMuntjac  -----ttggaatacagtat-aaaagattc
                 ReevesMuntjac  -----ttggaatacagtat-aaaagattc
                PereDavidsDeer  -----ttggaatacagtat-aaaagattc
               WhiteLippedDeer  -----ttggaatacagtat-aaaagattc
                   YarkandDeer  -----ttggaatacagtat-aaaagattc
                       RedDeer  -----ttggaatacagtat-aaaagattc
                       HogDeer  -----ttggaatacagtat-aaaagattc
               WhiteTailedDeer  -----ttggaatacagtat-aaaagattc
                      MuleDeer  -----ttggaatacagtat-aaaagattc
                      Reindeer  -----ttggaatacagtat-aaaagattc
                EasternRoeDeer  -----ttggaatacagtat-aaaagattc
                   EurasianElk  -----ttggaatacagtat-aaaagattc
              ChineseWaterDeer  -----ttggaatacagtat-aaaagattc
                       Giraffe  -----ttggaatacagtat-aaaagattc
                     Pronghorn  -----ttggaatacagtat-aaaagattc
                        Cattle  -----ttggaatacagtat-aaaagattc
                    ZebuCattle  -----ttggaatacagtat-aaaagattc
              SiberianMuskDeer  -----ttggaatacagtat-aaaagattc
                         Okapi  -----ttggaatacagtat-aaaagattc

Alignment block 2 of 177 in window, 129059547 - 129059641, 95 bps 
B D  Oar_rambouillet_v1_0_addY  agccaatcacagatcccgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                        Rabbit  agccaatcatagaccctgacgacac--ttgtctcatctaagttggaa-tat-aaaaagcca-c-ttggaa
                GreenSeaTurtle  agccaatcatcggttttgacgacac--gagtctaaccaaagttggag-tat-aaaagccct-c-ttcgaa
                         Horse  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
               ChinesePangolin  agccaatcgtagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                         Human  agccaatcatagatcctgacgacac--ttgtctcatctaagttggaa-tat-aaaaagcca-c-ttggaa
                      Aardvark  agccaatcataggtcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                     BlueWhale  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
       CommonBottlenoseDolphin  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                   BelugaWhale  aaccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                           Pig  agccaatcatagatcctgacgacac--ttgtctcatcaag--tggaa-tat-aaaaagcca-c-ttggaa
                FloridaManatee  agccaatcataggtcctgacgacac--ttgtctcatcaacgttggaa-tat-aaaaagcca-c-ttggaa
                       Tuatara  agccaatcattggatttgacgacat--gagtctaatcaaagttggagttat-aaaaagccctc-ctggaa
           GreaterHorseshoeBat  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
       WesternEuropeanHedgehog  agccaatcataggtcctgacgacac--ttg-ctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
B                      chicken  aaccaatcgtcggttttgacgacat--gagcctaatcaaagttggag-tat-aaaagcccc-c-ttggca
                  MonkParakeet  aaccaatcgtcgggtttgacgacat--gagcctaatcaaagttggag-tataaaaagcccc-c-ttggaa
                    HouseMouse  agccaatcatagatcctgacgacac--ttgtctcctctaagttggaa-tat-aaaaagcca-c-ttggaa
              ChineseTreeShrew  agccaatcataggtcctgacgacac--ttgtctcatccaagttgcaa-tat-aaaaagcca-c-ttggca
                    RockPigeon  aaccaatcgtcgggtttgacgacat--gagcctaatcaaagttggag-tataaaaagcccc-c-ttgg--
            TropicalClawedFrog  agccaatccgcagttttgatgacac--aagcgtaacttaagttgacc-tat-aaaagtaca-t-gtgg--
                        Alpaca  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
             WildBactrianCamel  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                  ArabianCamel  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                           Dog  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                    MinkeWhale  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcta-c-ttggaa
                   KillerWhale  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                    SpermWhale  agccaatcatagatcctgacgacac--ttgtctcatcaaagttggaa-tat-aaaaagcca-c-ttggaa
                ChacoanPeccary  agccaatcatagatcctgacgacac--ttgtctcatcaag--tggaa-tat-aaaaagcca-c-ttggaa
                    Coelacanth  agccaatcaccgattttgacgacacaatagtgtaaccatagttgagg-tat-aaaaagccc-tgttggta

     Oar_rambouillet_v1_0_addY  tacagtataaaagattcactggtgtggcaag
                        Rabbit  tacagtatcaaagatccaccggtgtggcaag
                GreenSeaTurtle  aa-----tatatgattcaccagtgtggcaag
                         Horse  tacagtataaaagattcactggtgtggcaag
               ChinesePangolin  tacagtataaaagattcactggtgtggcgag
                         Human  tacagtataaaagattcactggtgtggcaag
                      Aardvark  tacagtataaaagaatcactggtgtggcaag
                     BlueWhale  tacagtataaaagattcactggtgtggcaag
       CommonBottlenoseDolphin  tacagtataaaagattcactggtgtggcaag
                   BelugaWhale  tacagtataaaagattcactggtgtggcaag
                           Pig  tacagtataaaagattcactggtgtggcaag
                FloridaManatee  tacagtataaaagattcactggtgtggcaag
                       Tuatara  tatat----aaggattcagccatgtggtgag
           GreaterHorseshoeBat  tacagtataaaagattcactggtgtggcaag
       WesternEuropeanHedgehog  tacagtataaaagattcactggtgtggcaag
                       chicken  -----tatataaggcacaccagtgtggcaag
                  MonkParakeet  -----tatataaggtacaccagtgtggcaag
                    HouseMouse  tacagtatacaggactccctggcgtggcagg
              ChineseTreeShrew  tacagtataaaagactcactggtgtggcaag
                    RockPigeon  ---aatatataaggtacaccagtgtggcaag
            TropicalClawedFrog  ---actttgcatgatttattagtgtgacaga
                        Alpaca  tacagtataaaagattcactggtgtggcaag
             WildBactrianCamel  tacagtataaaagattcactggtgtggcaag
                  ArabianCamel  tacagtataaaagattcactggtgtggcaag
                           Dog  tacagtataaaagattcactggggtggcaag
                    MinkeWhale  tacagtataaaagattcactggtgtggcaag
                   KillerWhale  tacagtataaaagattcactggtgtggcaag
                    SpermWhale  tacagtataaaagattcactggtgtggcaag
                ChacoanPeccary  tacagtataaaagattcactggtgtggcaag
                    Coelacanth  -----tgtatgagatttatcagtgtggtgag

Alignment block 3 of 177 in window, 129059628 - 129060182, 555 bps 
B D  Oar_rambouillet_v1_0_addY  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                 JavaMouseDeer  gctggtgtggcaagttgtctctcagactgtgcaggcactaac----gttttgcttggcattactcacacg
                         Bongo  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                         Saiga  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                         Gayal  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                    LesserKudu  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                     Sitatunga  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                 MountainNyala  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
               LesserMouseDeer  gctggtgtggcaagttgtctctcagactgtgcaggcactaac----gttttgcttggcattactcacacg
                AlpineMuskDeer  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttgctcaaaag
                WesternRoeDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                          Gaur  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                 AmericanBison  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                       WildYak  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                   DomesticYak  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  WaterBuffalo  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                AfricanBuffalo  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                   CommonEland  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                   GreaterKudu  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                      Bushbuck  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggagttactcaaaag
                        Impala  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                          Suni  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  Klipspringer  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                 RoyalAntelope  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgtgactcaaaag
                   KirksDikDik  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
            PrzewalskisGazelle  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                         Oribi  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
               ThomsonsGazelle  actggtgtggcaagttgtctctcagactgggcaggcagtaacgtttgtttggcttggcgttactcaaaag
                 GrantsGazelle  actggtgtggcaagttgtctctcagactgggcaggcagtaacgtttgtttggcttggcgttactcaaaag
                       Gerenuk  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                     Springbok  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                MaxwellsDuiker  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                 HarveysDuiker  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                 BohorReedbuck  actggtgtggcaagttgtctctctgactgggcaggcattaac----gtttggcttggcgttactcaaaag
              DefassaWaterbuck  actggtgtggcaagttgtctctctgactgggcaggcattaac----gtttggcttggcgttactcaaaag
                        Lechwe  actggtgtggcaagttgtctctctgactgggcaggcattaac----gtttggcttggcgttactcaaaag
                       Gemsbok  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
            ScimitarHornedOryx  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  RoanAntelope  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                 SableAntelope  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                BlueWildebeest  actggtgtggcaagttgtctcttagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                          Topi  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                        Herola  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
               TibetanAntelope  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  MountainGoat  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
               EuropeanMouflon  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                AsiaticMouflon  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                     SnowSheep  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  BighornSheep  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  BarbarySheep  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                        Bharal  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcattactcaaaag
                   NilgiriTahr  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
B D                       ARS1  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                      WildGoat  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                  SiberianIbex  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
         ChineseForestMuskDeer  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttgctcaaaag
                  BlackMuntjac  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                 IndianMuntjac  actggtgtggcaagttgtctctcagcctgagcaggcattaac----gtttggcttggcgttactcaaaag
                 ReevesMuntjac  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                PereDavidsDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
               WhiteLippedDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                   YarkandDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                       RedDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                       HogDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
               WhiteTailedDeer  actggtgtgtcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                      MuleDeer  actggtgtgtcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                      Reindeer  actggtgtgtcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                EasternRoeDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                   EurasianElk  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
              ChineseWaterDeer  actggtgtggcaagttgtctctcagcctgggcaggcattaac----gtttggcttggcgttactcaaaag
                       Giraffe  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactgaaaag
                     Pronghorn  actggtgtggtaagtggcctctcagactgggcaggcattacc----gtttggcttggcgttactcaaaag
                        Cattle  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
                    ZebuCattle  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag
              SiberianMuskDeer  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttgctcaaaag
                         Okapi  actggtgtggcaagttgtctctcagactgggcaggcattaac----gtttggcttggcgttactcaaaag

     Oar_rambouillet_v1_0_addY  c-aaaagaaaagtaaaagg-------aagcagtaagagcaaggaaaaagattgt-attgattttaaaacc
                 JavaMouseDeer  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagaccgt-agtgattttaaaatc
                         Bongo  c-aaaagaaaagtaaaagg-------aagaagtaagatcaagggaaaagattgt-attgattttaaaacc
                         Saiga  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaacaagattgc-actgattttaaaacc
                         Gayal  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                    LesserKudu  c-aaaagaaaagtaaaagg-------aagaagtaagaaccagggaaaagattgt-actgattttaaaacc
                     Sitatunga  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                 MountainNyala  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
               LesserMouseDeer  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagaccgt-agtgattttaaaatc
                AlpineMuskDeer  c-agaagaaaagtaaaagg-------aagaagtaagaacaagggaaaa-attgt-attgattttaaaacc
                WesternRoeDeer  caaaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagactgt-cttgattttaaaatc
                          Gaur  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                 AmericanBison  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                       WildYak  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                   DomesticYak  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                  WaterBuffalo  c-aaaagaaaagtaaaagg-------aag----aagaacaagggaaaagattgt-attgattttaaaacc
                AfricanBuffalo  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                   CommonEland  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                   GreaterKudu  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                      Bushbuck  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                        Impala  c-aaaagaaaagcaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                          Suni  c-aaaagaaaagtaaaagg-------aagaagtgagaacaaggaaaaagattgt-attgattttaaaacc
                  Klipspringer  c-aaacgaaaagtaaaagg-------aaggagtaagaacaaggaaaaagattgt-attgattttaaaacc
                 RoyalAntelope  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                   KirksDikDik  c-aaaagaaaagtaaaagg-------aagaagtaagaataaggaaaaagattgt-attgattttaaaacc
            PrzewalskisGazelle  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgc-attgattttaaaacc
                         Oribi  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgc-attgattttaaaacc
               ThomsonsGazelle  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgc-actgattttaaaacc
                 GrantsGazelle  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgc-actgattttaaaacc
                       Gerenuk  c-aaaagaaaagtaaaaga-------aagaagtaagaacaaggaaaaagattgc-attgattttaaaacc
                     Springbok  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgc-attgattttaaaacc
                MaxwellsDuiker  c-aaaagaaaagtaaaagg-------aagaagtcagaacaaggaaaaagattgt-attgattttaaaacc
                 HarveysDuiker  c-aaaagaaaagtaaaagg-------aagaagtcagaacaaggaaaaagattgt-attgattttaaaacc
                 BohorReedbuck  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
              DefassaWaterbuck  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
                        Lechwe  c-aaaagaaaagtaaaagg-------aagaagcaagagcaaggaaaaagattgt-attgattttaaaacc
                       Gemsbok  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
            ScimitarHornedOryx  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                  RoanAntelope  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                 SableAntelope  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                BlueWildebeest  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                          Topi  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-gttgattttaaaacc
                        Herola  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-gttgattttaaaacc
               TibetanAntelope  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                  MountainGoat  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
               EuropeanMouflon  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
                AsiaticMouflon  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
                     SnowSheep  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
                  BighornSheep  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
                  BarbarySheep  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                        Bharal  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
                   NilgiriTahr  c-aaaagaaaagtaaaagg-------aagaagtaagagcaaggaaaaagattgt-attgattttaaaacc
                          ARS1  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attg-----aaaacc
                      WildGoat  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attg-----aaaacc
                  SiberianIbex  c-aaaagaaaagtaaaagg-------aagaagtaagaacaaggaaaaagattgt-attgattttaaaacc
         ChineseForestMuskDeer  c-agaagaaaagtaaaagg-------aagaagtaagaacaagggaaaa-attgt-attgattttaaaacc
                  BlackMuntjac  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                 IndianMuntjac  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                 ReevesMuntjac  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                PereDavidsDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
               WhiteLippedDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                   YarkandDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                       RedDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                       HogDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
               WhiteTailedDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                      MuleDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                      Reindeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                EasternRoeDeer  caaaaagaaaagtaaacag-------aagaaggaagaacaagggaaaagactgt-cttgattttaaaatc
                   EurasianElk  c-aagagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
              ChineseWaterDeer  c-aaaagaaaagtaaacgg-------aagaaggaagaacaagggaaaagattgt-cttgattttaaaacc
                       Giraffe  c-aaaagaaaagaaaaaggaagaagtaagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                     Pronghorn  c-aaaggaaaagtaaaagg-------aagaagtaggaacaaggggaaagactgtaattgattttaaaacc
                        Cattle  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
                    ZebuCattle  c-aaaagaaaagtaaaagg-------aagaagtaagaacaagggaaaagattgt-attgattttaaaacc
              SiberianMuskDeer  c-agaagaaaagtaaaagg-------aagaagtaagaacaagggaaaa-attgt-attgattttaaaacc
                         Okapi  c-aaaagaaaagaaaaagg-------aagaagtaagaacaagagaaaagattgt-attgattttaaaacc

     Oar_rambouillet_v1_0_addY  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                 JavaMouseDeer  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggtccagtggatctga
                         Bongo  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                         Saiga  atgcaaaaactgcaaatctttgtttatatttccctatttatgctgattgttgctggcccagtggatctga
                         Gayal  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                    LesserKudu  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                     Sitatunga  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                 MountainNyala  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
               LesserMouseDeer  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggtccagtggatctga
                AlpineMuskDeer  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                WesternRoeDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgactgttgctggcccagtggatctga
                          Gaur  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                 AmericanBison  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                       WildYak  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                   DomesticYak  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                  WaterBuffalo  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                AfricanBuffalo  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                   CommonEland  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                   GreaterKudu  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                      Bushbuck  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                        Impala  atgcaaaaactgcaaatctttgtttatatttacctatttgtgctgattgttgctggccccgtggatctga
                          Suni  atgcaaaaactgcaaatctttgtttatatttacctatttgtgctgattgttgctggcccagtggatctga
                  Klipspringer  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                 RoyalAntelope  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggtccagtggatctga
                   KirksDikDik  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
            PrzewalskisGazelle  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                         Oribi  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
               ThomsonsGazelle  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctagcccagtggatctga
                 GrantsGazelle  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                       Gerenuk  atgcaaaaactgcaaatctttgtttacatttacctatttatgctgactgttgctggcccagtggatctga
                     Springbok  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggccccgtggatctga
                MaxwellsDuiker  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                 HarveysDuiker  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgactgttgctggcccagtggatctga
                 BohorReedbuck  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
              DefassaWaterbuck  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                        Lechwe  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                       Gemsbok  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
            ScimitarHornedOryx  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                  RoanAntelope  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                 SableAntelope  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                BlueWildebeest  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                          Topi  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                        Herola  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
               TibetanAntelope  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                  MountainGoat  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
               EuropeanMouflon  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                AsiaticMouflon  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                     SnowSheep  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                  BighornSheep  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                  BarbarySheep  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                        Bharal  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                   NilgiriTahr  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                          ARS1  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                      WildGoat  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
                  SiberianIbex  atgcaaaaactgcaaatctttgtttatatttacctatttatgctgcttgttgctggcccagtggatctga
         ChineseForestMuskDeer  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                  BlackMuntjac  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                 IndianMuntjac  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                 ReevesMuntjac  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                PereDavidsDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
               WhiteLippedDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                   YarkandDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                       RedDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                       HogDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
               WhiteTailedDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggccccgtggatctga
                      MuleDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggccccgtggatctga
                      Reindeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggccccgtggatctga
                EasternRoeDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgactgttgctggcccagtggatctga
                   EurasianElk  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
              ChineseWaterDeer  atgcaaaaactgcaaatctgtgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                       Giraffe  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                     Pronghorn  atgcaaaaactgcaaatctatgtttatatttacctatctatgctgattgttgctggccccgtggatctga
                        Cattle  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
                    ZebuCattle  atgcaaaaactgcaaatctctgtttatatttacctatttatgctgattgttgctggcccagtggatctga
              SiberianMuskDeer  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggcccagtggatgtga
                         Okapi  atgcaaaaactgcaaatctatgtttatatttacctatttatgctgattgttgctggcccagtggatctga

     Oar_rambouillet_v1_0_addY  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgcttgtggagacaaaa
                 JavaMouseDeer  atgagaacagcgagcaaaaggaaaatgtagaaaaagaggggctgtgtaatgcatgtctgtggagacaaaa
                         Bongo  atgagaagagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                         Saiga  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                         Gayal  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                    LesserKudu  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                     Sitatunga  atgagaagagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                 MountainNyala  atgagaagagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
               LesserMouseDeer  atgagaacagcgagcaaaaggaaaatgtagaaaaagaggggctgtgtaatgcatgtctgtggagacaaaa
                AlpineMuskDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                WesternRoeDeer  atgaggacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                          Gaur  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                 AmericanBison  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                       WildYak  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                   DomesticYak  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                  WaterBuffalo  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                AfricanBuffalo  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                   CommonEland  atgagaagagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                   GreaterKudu  atgagaagagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                      Bushbuck  atgagaagagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                        Impala  atgagaacagcgagcagaaggaatatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                          Suni  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                  Klipspringer  atgagaacagcgagcagaaggaaaatgtggacaaaaaggggctgtgtaatgcatgtgtgtggagacaaaa
                 RoyalAntelope  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                   KirksDikDik  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
            PrzewalskisGazelle  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                         Oribi  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
               ThomsonsGazelle  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                 GrantsGazelle  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                       Gerenuk  atgggaacagcgagcagaaggaaaatgcgggaaaaaaggggctgtgtaacgcgtgtttgtggagacagag
                     Springbok  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                MaxwellsDuiker  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                 HarveysDuiker  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                 BohorReedbuck  atgagaacagcgagcagaaggaaaatgtggaaaatcaggggctgtgtaatgcatgtttgtggagacaaaa
              DefassaWaterbuck  atgagaacagcgagcagaaggaaaatgtggaaaatcaggggctgtgtaatgcatgtttgtggagacaaaa
                        Lechwe  atgagaacagcgagcagaaggaaaatgtggaaaatcaggggctgtgtaatgcatgtttgtggagacaaaa
                       Gemsbok  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
            ScimitarHornedOryx  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                  RoanAntelope  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                 SableAntelope  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                BlueWildebeest  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                          Topi  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                        Herola  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
               TibetanAntelope  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                  MountainGoat  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
               EuropeanMouflon  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgcttgtggagacaaaa
                AsiaticMouflon  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgcttgtggagacaaaa
                     SnowSheep  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgcttgtggagacaaaa
                  BighornSheep  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgcttgtggagacaaaa
                  BarbarySheep  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                        Bharal  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                   NilgiriTahr  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                          ARS1  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                      WildGoat  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
                  SiberianIbex  atgagaacagcgagcagaaggaaaatgtggaaaaaaaggggctgtgtaatgcatgtttgtggagacaaaa
         ChineseForestMuskDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                  BlackMuntjac  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                 IndianMuntjac  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                 ReevesMuntjac  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                PereDavidsDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
               WhiteLippedDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                   YarkandDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                       RedDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                       HogDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
               WhiteTailedDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                      MuleDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                      Reindeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                EasternRoeDeer  atgaggacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                   EurasianElk  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
              ChineseWaterDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                       Giraffe  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                     Pronghorn  atgagaacagcgagcagaaggaaaatggggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                        Cattle  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
                    ZebuCattle  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagggaaaa
              SiberianMuskDeer  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa
                         Okapi  atgagaacagcgagcagaaggaaaatgtggaaaaagaggggctgtgtaatgcatgtttgtggagacaaaa

     Oar_rambouillet_v1_0_addY  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                 JavaMouseDeer  cactaaatcctcaagactagaagctataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                         Bongo  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                         Saiga  caataaatcctcgagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                         Gayal  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                    LesserKudu  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                     Sitatunga  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 MountainNyala  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
               LesserMouseDeer  cactaaatcctcaagactagaagctataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                AlpineMuskDeer  cactaaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                WesternRoeDeer  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                          Gaur  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 AmericanBison  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                       WildYak  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   DomesticYak  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                  WaterBuffalo  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                AfricanBuffalo  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   CommonEland  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   GreaterKudu  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                      Bushbuck  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                        Impala  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                          Suni  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                  Klipspringer  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagcgcct
                 RoyalAntelope  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   KirksDikDik  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
            PrzewalskisGazelle  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                         Oribi  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
               ThomsonsGazelle  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 GrantsGazelle  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                       Gerenuk  caataaatcctcaagactagaagccataaagatccaaatcctcagcaagcttcgcctggaaacagctcct
                     Springbok  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                MaxwellsDuiker  cagtaaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 HarveysDuiker  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 BohorReedbuck  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
              DefassaWaterbuck  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                        Lechwe  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                       Gemsbok  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
            ScimitarHornedOryx  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaactgcgcctggaaacagctcct
                  RoanAntelope  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 SableAntelope  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                BlueWildebeest  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                          Topi  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                        Herola  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
               TibetanAntelope  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                  MountainGoat  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
               EuropeanMouflon  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                AsiaticMouflon  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                     SnowSheep  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                  BighornSheep  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                  BarbarySheep  caataaatcctcgagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                        Bharal  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   NilgiriTahr  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                          ARS1  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                      WildGoat  caataaatcctcaagactagaagccataaaaatccaaattctcagtaaacttcgcctggaaacagctcct
                  SiberianIbex  caataaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
         ChineseForestMuskDeer  cactaaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                  BlackMuntjac  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 IndianMuntjac  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                 ReevesMuntjac  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                PereDavidsDeer  cactaaatccttaaggctagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
               WhiteLippedDeer  cactaaatccttaaggctagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   YarkandDeer  cactaaatccttaaggctagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                       RedDeer  cactaaatccttaaggctagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                       HogDeer  cactaaatccttaaggctagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
               WhiteTailedDeer  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                      MuleDeer  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                      Reindeer  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                EasternRoeDeer  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                   EurasianElk  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
              ChineseWaterDeer  cactaaatccttaagactagaagccataaaaatccaaatcctcagtaagcttcgcctggaaacagctcct
                       Giraffe  cactaaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                     Pronghorn  cactaaatcctcaagactagaagccataaaaatccaaatcctcagtaaactgcgcctggaaacagctcct
                        Cattle  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                    ZebuCattle  cactacatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
              SiberianMuskDeer  cactaaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct
                         Okapi  cactaaatcctcaagactagaagccataaaaatccaaatcctcagtaaacttcgcctggaaacagctcct

     Oar_rambouillet_v1_0_addY  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                 JavaMouseDeer  aacatcagcaaagatgctatcagacaacttttgcccaaagctcctccactccgggaactgattgatcagt
                         Bongo  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                         Saiga  aacatcagcaaagatgctataagacaacttctgcccaaggctcctccactccgggaactgattgatcagt
                         Gayal  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                    LesserKudu  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                     Sitatunga  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                 MountainNyala  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
               LesserMouseDeer  aacatcagcaaagatgctatcagacaacttttgcccaaagctcctccactccgggaactgattgatcagt
                AlpineMuskDeer  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                WesternRoeDeer  aacatcagcaaagatgctgtaagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                          Gaur  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                 AmericanBison  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                       WildYak  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                   DomesticYak  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                  WaterBuffalo  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                AfricanBuffalo  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                   CommonEland  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                   GreaterKudu  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                      Bushbuck  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                        Impala  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggagctgattgatcagt
                          Suni  aacatcagcaaagatgctatacgacaacttttgcccaaggctcccccactccgggaactgattgatcagt
                  Klipspringer  aacatcagcaaagatgctataagacaacttttgcccagggctcctccactccgggaactgattgatcagt
                 RoyalAntelope  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                   KirksDikDik  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
            PrzewalskisGazelle  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                         Oribi  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
               ThomsonsGazelle  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgatcgatcagt
                 GrantsGazelle  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                       Gerenuk  aacatcagcaaagatgcgataagacagcttttgcccaaggctcctccactccgggaactgattgatcagt
                     Springbok  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                MaxwellsDuiker  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatgagt
                 HarveysDuiker  aacatcagcaaagatgctattagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                 BohorReedbuck  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
              DefassaWaterbuck  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                        Lechwe  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                       Gemsbok  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactaattgatcagt
            ScimitarHornedOryx  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactaattgatcagt
                  RoanAntelope  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactaattgatcagt
                 SableAntelope  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactaattgatcagt
                BlueWildebeest  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                          Topi  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                        Herola  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
               TibetanAntelope  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                  MountainGoat  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
               EuropeanMouflon  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                AsiaticMouflon  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                     SnowSheep  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                  BighornSheep  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                  BarbarySheep  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                        Bharal  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                   NilgiriTahr  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                          ARS1  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                      WildGoat  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                  SiberianIbex  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
         ChineseForestMuskDeer  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                  BlackMuntjac  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                 IndianMuntjac  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                 ReevesMuntjac  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                PereDavidsDeer  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
               WhiteLippedDeer  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                   YarkandDeer  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                       RedDeer  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                       HogDeer  aacatcagcaaagatgctataagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
               WhiteTailedDeer  aacatcagcaaagatgctgtaagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                      MuleDeer  aacatcagcaaagatgctgtaagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                      Reindeer  aacatcagcaaagatgctgtaagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                EasternRoeDeer  aacatcagcaaagatgctgtaagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                   EurasianElk  aacatcagcaaagatgctgtaaggcaacttctgcccaaagctcctccattccaggaactgattgatcagt
              ChineseWaterDeer  aacatcagcaaagatgctgtgagacaacttctgcccaaagctcctccactccgggaactgattgatcagt
                       Giraffe  aacatcagcaaagatgctataagacaacttttgcccaaagctcccccactccgggaactgattgatcagt
                     Pronghorn  aacatcagcaaagatgctataagacaacttttgcccaaagctcccccgctccgggaactgatcgatcagt
                        Cattle  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
                    ZebuCattle  aacatcagcaaagatgctatcagacaacttttgcccaaggctcctccactcctggaactgattgatcagt
              SiberianMuskDeer  aacatcagcaaagatgctataagacaacttttgcccaaggctcctccactccgggaactgattgatcagt
                         Okapi  aacatcagcaaagatgctataagacaacttttgcccaaagctcccccactccgggaactgattgatcagt

     Oar_rambouillet_v1_0_addY  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                 JavaMouseDeer  acgatgtccagagagatgacagcagtgacggctccctggaagatgatgattaccacgctacgacggaaac
                         Bongo  tcgatatccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
                         Saiga  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                         Gayal  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                    LesserKudu  tcgatgtccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
                     Sitatunga  tcgatgtccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
                 MountainNyala  tcgatgtccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
               LesserMouseDeer  acgatgtccagagagatgacagcagtgacggctccctggaagatgatgattaccacgctacgacggaaac
                AlpineMuskDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgccaggacggaaac
                WesternRoeDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctaggacggaaac
                          Gaur  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                 AmericanBison  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                       WildYak  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                   DomesticYak  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                  WaterBuffalo  tcgatgtccagagagatgccggcagtgacggctccttggaagacgatgactaccacgccaggacggacgc
                AfricanBuffalo  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                   CommonEland  tcgatgtccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
                   GreaterKudu  tcgatgtccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
                      Bushbuck  tcgatgtccagggagatgccagcagtgacggctccttggaagacgatgattaccacgctaggacggaaac
                        Impala  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgctacgacggaaac
                          Suni  acgacgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgctacgacggaaac
                  Klipspringer  acgatgtccagcgagatgacagcagcgatggctccttggaagatgatgactaccatgtcacgacggaaac
                 RoyalAntelope  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                   KirksDikDik  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
            PrzewalskisGazelle  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                         Oribi  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
               ThomsonsGazelle  acgacgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgtttcgacggagac
                 GrantsGazelle  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                       Gerenuk  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                     Springbok  acgatatccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                MaxwellsDuiker  acgatgtccagcgagatgacagcagcgacggctctttggaagacgatgactaccacgttacgacggaaac
                 HarveysDuiker  acgatgtccagagggatgacagcagcgacggctctttggaagacgatgactaccacgttacgacggaaac
                 BohorReedbuck  acgatgtccagagggatgagagcagcgacggctccttggaagacgatgactaccacgttacgaaggaaac
              DefassaWaterbuck  acgatgtccagagggatgagagcagcgacggctccttggaagacgatgactaccacgttacgaaggaaac
                        Lechwe  acgatgtccagagggatgagagcagcgacggctccttggaagacgatgactaccacgttacgaaggaaac
                       Gemsbok  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
            ScimitarHornedOryx  acgatatccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                  RoanAntelope  acgatgtccagagggatgacagcagcgacggctccttggaggacgatgactaccacgttacgacggaaac
                 SableAntelope  acgatatccagagggatgacagcagcgacggctccttggaggacgatgactaccacgttacgacggaaac
                BlueWildebeest  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                          Topi  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgctacgacggaaac
                        Herola  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgctacgacggaaac
               TibetanAntelope  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                  MountainGoat  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
               EuropeanMouflon  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                AsiaticMouflon  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                     SnowSheep  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                  BighornSheep  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                  BarbarySheep  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                        Bharal  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                   NilgiriTahr  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                          ARS1  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                      WildGoat  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
                  SiberianIbex  acgatgtccagagagatgacagcagcgacggctccttggaagacgatgactaccacgttacgacggaaac
         ChineseForestMuskDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgccaggacggaaac
                  BlackMuntjac  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                 IndianMuntjac  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                 ReevesMuntjac  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                PereDavidsDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
               WhiteLippedDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                   YarkandDeer  acgatgtccagagggatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                       RedDeer  acgatgtccagagggatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                       HogDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
               WhiteTailedDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                      MuleDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                      Reindeer  acgacgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                EasternRoeDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctaggacggaaac
                   EurasianElk  acgacgtccagagagatgacagcagcgacggctccctggaggatgatgactaccacgctaggacggaaac
              ChineseWaterDeer  acgatgtccagagagatgacagcagtgaccgctccttggaagatgatgactaccacgctaggacggaaac
                       Giraffe  acgatatccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac
                     Pronghorn  acgacgtccagagagatgacagcagtgacggctccttggaagacgatgactaccacgctacgacggaaac
                        Cattle  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
                    ZebuCattle  tcgatgtccagagagatgccagcagtgacggctccttggaagacgatgactaccacgccaggacggaaac
              SiberianMuskDeer  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgccaggacggaaac
                         Okapi  acgatgtccagagagatgacagcagtgacggctccttggaagatgatgactaccacgctacgacggaaac

     Oar_rambouillet_v1_0_addY  ggtc-attaccatgcccacggagtgtgagtagttctgctagggcagagcaacgactctgctgactgctgt
                 JavaMouseDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgttagtgcagagcaacgattctgctgacggttgt
                         Bongo  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                         Saiga  agtc-attaccatgcccacagagtgtgagtagttctgctagtgcagagcagcgactctgctgactgctgc
                         Gayal  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                    LesserKudu  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                     Sitatunga  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                 MountainNyala  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
               LesserMouseDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgttagtgcagagcaacgattctgctgacggttgt
                AlpineMuskDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgt-agtgcagagcagcggttctgctgactgctgt
                WesternRoeDeer  ggtc-attaccatgccctcggagtgtgagtagtcctgcgagtgcagagccacgattctgctgactgttgt
                          Gaur  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                 AmericanBison  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                       WildYak  ggtc-attaccatgcccacggagtgtgagtagtcttgctggtgcagagcaacgactctgctgactgctgt
                   DomesticYak  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                  WaterBuffalo  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcggagcagcggctctgctggccgctgt
                AfricanBuffalo  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcagcgactctgctgactgctgt
                   CommonEland  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                   GreaterKudu  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                      Bushbuck  ggtc-atcaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                        Impala  ggtc-attaccatgcccacggagtgtgagtagttctgctagcgcagagcgacgactctgctgactgctgt
                          Suni  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagccacgactctgctgactgctgt
                  Klipspringer  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagggcagcggctctgccgactgctgt
                 RoyalAntelope  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
                   KirksDikDik  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaccgactctgctgactgctgt
            PrzewalskisGazelle  ggtc-attgccatgcccacagagtgtgagtagttctgctagtgcagagccacgactctgctgactgctgt
                         Oribi  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
               ThomsonsGazelle  agtc-atcaccatgcccacggagtgtgagtagttctgctagtgcagagcagagactctgctgaccgctgc
                 GrantsGazelle  agtc-atcaccatgcccacggagtgtgagtagttctgctagtgcagagcagcgactctgctgactgctgc
                       Gerenuk  agtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcagcgactctgctgactgctgt
                     Springbok  agtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcagcgactctgctgactgctgt
                MaxwellsDuiker  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
                 HarveysDuiker  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
                 BohorReedbuck  ggtc-atcaccatgcccacggagtgtgagtagttctgctagtgcagagcaacggctctgctgacggctgt
              DefassaWaterbuck  ggtc-atcaccatgcccacggagtgtgagtagttctgctagtgcagagcaacggctctgctgacggctgt
                        Lechwe  ggtc-atcaccatgcccacggagtgtgagtagttctgctagtgcagagcaacggctctgctgacggctgt
                       Gemsbok  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
            ScimitarHornedOryx  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
                  RoanAntelope  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
                 SableAntelope  ggtc-attaccatgcccacggagtgtgagtagttctgctggtgcagagcaacgactctgctgactgctgt
                BlueWildebeest  ggtc-attaccatgcccacggagtgtgagtagttctcctagtgcagagcaacgactctgctgactgctgt
                          Topi  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                        Herola  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
               TibetanAntelope  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                  MountainGoat  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
               EuropeanMouflon  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                AsiaticMouflon  ggtc-attaccatgcccacggagtgtgagtagttctgctagggcagagcaacgactctgctgactgctgt
                     SnowSheep  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                  BighornSheep  ggtctattaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                  BarbarySheep  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                        Bharal  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                   NilgiriTahr  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                          ARS1  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                      WildGoat  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
                  SiberianIbex  ggtc-attaccatgcccacggagtgtgagtagttctgctagtgcagagcaacgactctgctgactgctgt
         ChineseForestMuskDeer  ggtc-attaccatgcccacggagtgtgagtagtcctg-tagtgcagagcagcggttctgctgactgctgt
                  BlackMuntjac  ggtc-attaccatgcccacggagtgtgagtagccttgctagtgcagagcgacgattctgctgactgttgt
                 IndianMuntjac  ggtc-attaccatgcccacggagtgtgagtagccttgctagtgcagagcgacgattctgctgactgttgt
                 ReevesMuntjac  ggtc-attaccatgcccacggagtgtgagtagccttgctagtgcagagcgacgattctgctgactgttgt
                PereDavidsDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgctagtgcagagcgacgattctgctgactgttgt
               WhiteLippedDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgctagcgcagagcgacgattctgctgactgttgt
                   YarkandDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgctagcgcagagcgacgattctgctgactgttgt
                       RedDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgctagcgcagagcgacgattctgctgactgttgt
                       HogDeer  ggtc-attaccatgcccacggagtgtgagtagtcctgctagtgcagagcgacgattctgctgactgttgt
               WhiteTailedDeer  ggtc-atcaccatgcccacggagtgtgagtagtcctgctagggcagagccacgattctgctgactgttgc
                      MuleDeer  ggtc-atcaccatgcccacggagtgtgagtagtcctgctagggcagagccacgattctgctgactgttgt
                      Reindeer  ggtc-atcaccatgcccacggagtgtgagtagtcctgctagggctgagccacgattctgctgactgttgt
                EasternRoeDeer  ggtc-attaccatgccctcggagtgtgagtagtcctgcgagtgcagagccacgattctgctgactgttgt
                   EurasianElk  ggtc-cttatcatgcccacggagtgtgagtagtcctgctagcgcggagccccgattctgctgactgttgc
              ChineseWaterDeer  ggtc-attaccatgccctcggagtgtgagtagtcctgcgagtgcagggccacgattctgctgactgttgt
                       Giraffe  ggtc-attaccatgcccacggagtgtgagtagtcctattagtgcagagcaacgattctgctgactgttgt
                     Pronghorn  ggtc-attaccatgcccacggagtgtgagtagtcctgctcgcgcagagccacggttctgctgactgccgt
                        Cattle  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
                    ZebuCattle  ggtc-attaccatgcccacggagtgtgagtagtcctgctggtgcagagcaacgactctgctgactgctgt
              SiberianMuskDeer  ggtc-attaccatgcccacggagtgtgagtagtcctg-tagtgcagagcagcggttctgctgactgctgt
                         Okapi  ggtc-attaccatgcccacggagtgtgagtagtcctattagtgcagagcaacgattctgctgactgttgt

     Oar_rambouillet_v1_0_addY  tctagtgtt
                 JavaMouseDeer  tctagtgtt
                         Bongo  tctagtgtt
                         Saiga  tctagtgct
                         Gayal  tctagtgtt
                    LesserKudu  tctagtgtt
                     Sitatunga  tctagtgtt
                 MountainNyala  tctagtgtt
               LesserMouseDeer  tctagtgtt
                AlpineMuskDeer  tctagtgtt
                WesternRoeDeer  tctagtgct
                          Gaur  tctagtgtt
                 AmericanBison  tctagtgtt
                       WildYak  tctagtgtt
                   DomesticYak  tctagtgtt
                  WaterBuffalo  tctagtgtt
                AfricanBuffalo  tctagtgtt
                   CommonEland  tctagcgtt
                   GreaterKudu  tctagtgtt
                      Bushbuck  tctagtgtt
                        Impala  gctagtgtt
                          Suni  tctggtgct
                  Klipspringer  tctagtgtt
                 RoyalAntelope  tctagtgtt
                   KirksDikDik  tctagtgtt
            PrzewalskisGazelle  tctagtgtt
                         Oribi  tctagtgtt
               ThomsonsGazelle  tctggtgct
                 GrantsGazelle  tctagtgct
                       Gerenuk  tctagtgtt
                     Springbok  tctagtgct
                MaxwellsDuiker  tctagtgtt
                 HarveysDuiker  tctagtgtt
                 BohorReedbuck  tctagtgtt
              DefassaWaterbuck  tctagtgtt
                        Lechwe  tctagtgtt
                       Gemsbok  tctagtgtt
            ScimitarHornedOryx  tctagtgtt
                  RoanAntelope  tctagtgtt
                 SableAntelope  tctagtgtt
                BlueWildebeest  tctagtgtt
                          Topi  tctagtgtt
                        Herola  tctagtgtt
               TibetanAntelope  tctagtgtt
                  MountainGoat  tctagtgtt
               EuropeanMouflon  tctagtgtt
                AsiaticMouflon  tctagtgtt
                     SnowSheep  tctagtgtt
                  BighornSheep  tctagtgtt
                  BarbarySheep  tctagtgtt
                        Bharal  tctagtgtt
                   NilgiriTahr  tctagtgtt
                          ARS1  tctagtgtt
                      WildGoat  tctagtgtt
                  SiberianIbex  tctagtgtt
         ChineseForestMuskDeer  tctagtgtt
                  BlackMuntjac  tctagtgtt
                 IndianMuntjac  tctagtgtt
                 ReevesMuntjac  tctagtgtt
                PereDavidsDeer  tctagtgtt
               WhiteLippedDeer  tctagtgtt
                   YarkandDeer  tctagtgtt
                       RedDeer  tctagtgtt
                       HogDeer  tctagtgtt
               WhiteTailedDeer  tctagtgtt
                      MuleDeer  tctagtgtt
                      Reindeer  tctagtgtt
                EasternRoeDeer  tctagtgct
                   EurasianElk  tctagtgtt
              ChineseWaterDeer  tctagtgtt
                       Giraffe  tctagtgtt
                     Pronghorn  tctagtgtt
                        Cattle  tctagtgtt
                    ZebuCattle  tctagtgtt
              SiberianMuskDeer  tctagtgtt
                         Okapi  tctagtgtt

Alignment block 4 of 177 in window, 129059642 - 129059782, 141 bps 
B D  Oar_rambouillet_v1_0_addY  t-tgtctctcagac------tgggcaggca-ttaa-cgtttggcttggcgttact---------caaaag
                        Rabbit  t-tgtctctcaagc------tgttcatgca-ttac-aattttgcttgccattact---------gaaaag
                GreenSeaTurtle  t-tgtttctcggat------tatactcgcctttag-ggatctgtttagtactg-----------------
                         Horse  t-tgtctctcagac------tgtacaggca-ttaa-aattttgcttggcattgct---------caaaag
               ChinesePangolin  t-tgtctctcagcc------tgcacaggca-ttaa-aattttgcttggcattact---------caaaac
                         Human  t-tgtctctcagac------tgtacatgca-ttaa-aattttgcttggcattact---------caaaag
                      Aardvark  t-gttctctcagac------tgtacatgca-ttaa-aaccttgcttggcattact---------caaaag
                     BlueWhale  t-tgtctctcagac------tgtgcaggca-ttaa-cattttgcttggcattact---------caaaag
       CommonBottlenoseDolphin  t-tgtctctcagac------tgtgcaggca-ttaa-cattttgcttggcattact---------caaaag
                   BelugaWhale  t-tgtctctcagac------tgtgcaggca-ttaa-cattttgcttggcattact---------caaaag
                           Pig  t-tgtctctcagac------agtgcaggca-ttaa-aattttgcttggcgttact---------caaaag
                FloridaManatee  tgtgtctctcagac------tgtacgtgca-ttaa-aattttgcttggcattact---------caaaag
                       Tuatara  t-tgtctctcagtt------tgcactttca-ttta-gtcatccatt--tagtact---------taaagg
           GreaterHorseshoeBat  t-tgtctctccgac------tgtacaggca-ttaa-aatttggcttggcattact---------caaaag
       WesternEuropeanHedgehog  t-tgtc-cactgac------tgtacaggca-ttca-atttttgcttggcattata---------caaaag
B                      chicken  c-cgtctctcagat------tgcatttgct-gtcacggatctgtttagaact-------------gaaag
                  MonkParakeet  c-tgtctctcagat------tgcatttgct-ttcacggatctgtttagtact-------------gaaag
                    HouseMouse  t-tgtctctcggacggtacatgcactaa--------tatttcacttggcattact---------caaaag
              ChineseTreeShrew  t-tgtctctcagac-gtgcatgcattaa--------aatcttgcttggcgttact---------caaaag
                    RockPigeon  c-tgtctctcagat------tgcatttgct-ttcacggatctatttagtaccaaaagggaaaggggaagg
            TropicalClawedFrog  t-tgactttaaact------tacattag--------gagtcagtttgactccaca---------ttaagg
                        Alpaca  t-tgtctctcaggc------tgtgcaggca-ttaa-aattttgcttggcattact---------caaaag
             WildBactrianCamel  t-tgtctctcaggc------tgtgcaggca-ttaa-aattttccttggcattact---------caaaag
                  ArabianCamel  t-tgtctctcaggc------tgtgcaggca-ttaa-aattttgcttggcattact---------caaaag
                           Dog  t-tgtctctcagac------tgtacaggct-ctag-gattttgcttggcattact---------caaaag
                    MinkeWhale  t-tgtctctcagac------tgtgcaggca-ttaa-cattttgcttggcattact---------caaaag
                   KillerWhale  t-tgtctctcagac------tgtgcaggca-ttaa-cattttgcttggcattact---------caaaag
                    SpermWhale  t-tgtctctcagac------tgtgcaggca-ttaa-cattttgcttggcattact---------caaaag
                ChacoanPeccary  t-tgtctgtcacac------agtgcaggca-ttaa-aattttgcgtggcgttact---------caaaag

     Oar_rambouillet_v1_0_addY  caaaagaaa---agt---aaaag-gaagcagtaagagcaag-----g-----aaaaagattgtattga-t
                        Rabbit  caaaagaaa---agt---aaaag-gaagacataagaacaag-----g-----gaaaggattgtatagc-t
                GreenSeaTurtle  --aaagaaa---aaa---ataag-aaagcaa-----ggaag-----g-----gaaaagactgcactga-a
                         Horse  caaaagaaa---agt---aaaag-gaagaaataagagcaag-----g-----aaaaagattgaactga-t
               ChinesePangolin  caaaagaaa---aat---aaaag-gaaggaataagaacaag-----a-----aaaagatttgtattga-c
                         Human  caaaagaaa---agt---aaaag-gaagaaacaagaacaag-----a-----aaaaagattatattga-t
                      Aardvark  caaaagaga---agt---aaga--gaagaaataagaacaag-----g-----aaaaagattgtattga-t
                     BlueWhale  caaaagaaa---agt---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtactga-t
       CommonBottlenoseDolphin  caaaagaaa---agt---aaaag-gaagaaataagaacaag-----g-----aaaaagattgtattga-t
                   BelugaWhale  caaaagaaa---agt---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtattga-t
                           Pig  c-----aaa---agt---aaaag-gaagaaataagaacaag-----g-----agaaagattgtattga-t
                FloridaManatee  caaaagaaa---agt----aaaa-aaagacacaagaacaag-----g-----agaaagactgaattga-t
                       Tuatara  gaaaaaaaa---gacttagaaga-aaagaga-aaggaca-------g-----gaaaagactgcactga-a
           GreaterHorseshoeBat  caaaag-aa---aag---taaaagaaggaaataagaacaag-----g-----gaaaagattgtactga-t
       WesternEuropeanHedgehog  caaaagcaa---aag---gaaactaaaggaagaagaagaagaacaag-----gaaaagattgtggtga-t
                       chicken  aaaagggga---aag---ggaga---ggggggggaaaaaag-----g-----caaaaagctgcagtga-c
                  MonkParakeet  ggaaggggg---agg---ggaaa-----gaaaaaaaaaagg-----g-----aaaagcgctgcactga-a
                    HouseMouse  caaaaa----------------g--aagaaataagaacaag-----ggaaaaaaaaagattgtgctgatt
              ChineseTreeShrew  cagaaaccacgtaag-----agg--aaggaacaagagcaag-----g-----aaaaagattgtattga-t
                    RockPigeon  gaaaaagaa---aag---gaaga--aaaaaaaaagaaaaag-----g---aaaaaaagctgcagtgaa--
            TropicalClawedFrog  caacaagaaaataag---ggggg--aaagaaataaaaaaaa-----c---ctcaagagattctgacta--
                        Alpaca  caaaagaaa---aat---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtcttga-t
             WildBactrianCamel  caaaagaaa---aat---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtcttga-t
                  ArabianCamel  caaaagaaa---aat---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtcttga-t
                           Dog  caaaacaaa---agg---aaaag-gaagaaataagaacgag-----g-----aaaaagagtgtgctga-c
                    MinkeWhale  caaaagaaa---agt---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtactga-t
                   KillerWhale  caaaagaaa---agt---aaaag-gaagaaataagaacaag-----g-----aaaaagattgtattga-t
                    SpermWhale  caaaagaaa---agt---aaaag-gaagaaataagaacaag-----g-----gaaaagattgtattga-t
                ChacoanPeccary  caaaaga------------------aagaaataagaacaag-----g-----agaaagattgtattga-t

     Oar_rambouillet_v1_0_addY  tt-----taaaaccatgcaaaaactgcaaatctttgtttata
                        Rabbit  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
                GreenSeaTurtle  tg-----tgagatcatgcaaaagctacaaatctgtgtttata
                         Horse  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
               ChinesePangolin  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
                         Human  tt-----taaaatcatgcaaaaactgcaactctgtgtttata
                      Aardvark  tt-----taaaatgatgcaaaaactgcaaatccatgtttata
                     BlueWhale  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
       CommonBottlenoseDolphin  tt-----taaaatcatgcaaaaactgcaaatctatgtttgta
                   BelugaWhale  tt-----taaaatcatgcaaaaactgcaaatctatgtttgta
                           Pig  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
                FloridaManatee  tt-----caaaatcatgcaaaaactgcaaatctatgtttata
                       Tuatara  tt-----caagatcatgcataaactaaaaattgctacttgca
           GreaterHorseshoeBat  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
       WesternEuropeanHedgehog  ttaaaaaaaaaatcatgcaaaaacttcagatctttgtttata
                       chicken  tg-----taagatcatgcaaaagctagcagtctatgtttata
                  MonkParakeet  tg-----tgagatcatgcaaaagctagcaatctatgtttata
                    HouseMouse  tt-----taaaatgatgcaaaaactgcaaatgtatgtttata
              ChineseTreeShrew  tt-----taaaatcatgcaaaacctgcaaatctatgtttata
                    RockPigeon  tg-----tgagatcatgcaaaagctagcgatctatgtttata
            TropicalClawedFrog  ca-----taagaacatgataaaattacgtgcatggggttgta
                        Alpaca  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
             WildBactrianCamel  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
                  ArabianCamel  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
                           Dog  tt-----taaaatcatgcagagactgcaaatctgtgtttata
                    MinkeWhale  tt-----taaaatcatgcaaaaactgcaaatctatgtttata
                   KillerWhale  tt-----taaaatcatgcaaaaactgcaaatctatgtttgta
                    SpermWhale  tt-----ttaaatcatgcaaaaactgcaaatctatgtttata
                ChacoanPeccary  tt-----taaaatcatgcaaaaactgcaaatctatgtttata

Alignment block 5 of 177 in window, 129059783 - 129060143, 361 bps 
B D  Oar_rambouillet_v1_0_addY  tttacctatttatgctgcttgttgctggcccagtggatctgaatgagaacagcgagcagaaggaaaatgt
                        Rabbit  tttacctgtttatgctgatcgtggctggcccagtggatctaaatgaaaacagtgagcaaaaagaaaatgt
                GreenSeaTurtle  tttacctgttcatgctgattatacttggtccagtggctcttaatgacagtagtcagccaaaagagaatgg
                         Horse  tttacctgtttgtgctgattcttgctggtccagtggatctaaatgagaacagcgagcaaaaagaaaatgt
               ChinesePangolin  tttacctgtttatgctgattgttgctggtccagtggatctaaatgaaaacaccgagcagaaagaaactgt
                         Human  tttacctgtttatgctgattgttgctggtccagtggatctaaatgagaacagtgagcaaaaagaaaatgt
                      Aardvark  tttatctgtttatgctgattgttgctggtctagtggatctaaatgagaacaccgagcaaaaagaaaacgt
                     BlueWhale  tttacctatttatgctgattgttgctggtccagtggatctgaatgagaacagcgagcaaaaggaaaatgt
       CommonBottlenoseDolphin  tttacctatttatgctgattgttgctggtccagtggatctgaatgagaacagcgagcaaaaggaaaatgt
                   BelugaWhale  tttacctatttatgctgattgttgctggtccagtggatctgaatgagaacagcgagcaaaaggaaaatgt
                           Pig  tttacctgtttatgctgattgttgctggtcccgtggatctgaatgagaacagcgagcaaaaggaaaatgt
                FloridaManatee  tttacctgtttatgctgattgttgctggtccagtggatctaaatgagaacagcgagcaaaaagaaactgt
                       Tuatara  tttacctgttcatgctgattatacttgctccagtggatcttaatgatagtattcagccaaatgagaatac
           GreaterHorseshoeBat  tttacctgtttatgctgattgttgctggtccagtggatctaaatgagaacagcgagcaaaaagaaaatgt
       WesternEuropeanHedgehog  tttacctgtttatgctgattgttgctggtccggtgaatctaaatgagaacggcgaacagaaagaaaatgt
B                      chicken  tttacctgttcatgcagatcgcggttgatccagtggctctggatggcagtagtcagcccacagagaacgc
                  MonkParakeet  tttacctgttcatgctgatttcagttgatccagtggctcttgatgacggtagtcagcccacagagaacac
                    HouseMouse  tttacctgttcatgctgattgctgctggcccagtggatctaaatgagggcagtgagagagaagaaaatgt
              ChineseTreeShrew  tttacctgtttatgctgattgtggctggtcccgtggatctaaatgaaaacagtgagccaaaagaaaatgt
                    RockPigeon  tttacctgtgcatgctgatttcagttcatcccttggctcttgatgacgggagtcagcccacagagaactc
            TropicalClawedFrog  tttacttttgtatgctggtagtattaagcccagtggatctaacagacaacaatcgagcaaca--------
                        Alpaca  tttacctgtttatgctgattgttgctggtccagtggatctgaatgagaacaacgaacaaaaagaaaatgt
             WildBactrianCamel  tttacctgtttatgctgattgttgctggtccagtggatctgaatgagaacaacgaacaaaaagaaaatgt
                  ArabianCamel  tttacctgtttatgctgattgttgctggtccagtggatctgaatgagaacaacgaacaaaaagaaaatgt
                           Dog  tttacctgtttgtgctgattgttgctggcccagtcgatctaagtgagaacagtgagcaaaaagaaaatgt
                    Coelacanth  tttacctgtacgtgctggctgcactgagtccagtgggtctcactggtctgactcagactgtagaaaaagg
                    MinkeWhale  tttacctatttatgctgattgttgctggtccagtggatctgaatgagaacagcgagcaaaaggaaaatgt
                   KillerWhale  tttacctatttatgctgattgttgctggtccagtggatctgaatgagaacagcgagcaaaaggaaaatgt
                    SpermWhale  tttacctatttatgctgatggttgctggtccagtggatctgaatgagaacagcgagcaaaaggaaaatgt
                ChacoanPeccary  tttacctgtttatgctgattgttgctggtcccgtggatctgaatgagaacagcgagcaaaaggaaaatgt

     Oar_rambouillet_v1_0_addY  ggaaaaaaaggggctgtgtaatgcatgcttgtggagacaaaacaataaatcctcaagactagaagccata
                        Rabbit  ggaaaaagacgggctgtgtaatgcatgcacttggagacaaaacagtaaatattcaagaatagaagccata
                GreenSeaTurtle  agaaaaagatgaactatgcattgcatgtacatggaggcaaaatacaaaatcttccagaatagaagccata
                         Horse  ggaaaaagaggggctgtgcaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccata
               ChinesePangolin  ggaaaaagaagggctgtgtaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccata
                         Human  ggaaaaagaggggctgtgtaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccatt
                      Aardvark  ggaaaaagaggggccgtgtaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccata
                     BlueWhale  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcctcaagactagaagccata
       CommonBottlenoseDolphin  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcctcaagactagaagccata
                   BelugaWhale  ggaaaaagaggggctgtgtaatgcatgtatgtggaggcaaaacactaaatcctcaagactagaagccata
                           Pig  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcttcaagactagaagccata
                FloridaManatee  ggaaaaagaggggctgtgtaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccata
                       Tuatara  agaaaaagatggactctgcaatgcatgtacatggaggcaaaatacaaaatcttccagaatagaagccata
           GreaterHorseshoeBat  ggaaaaagaggggctgtgtaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccata
       WesternEuropeanHedgehog  ggaaaaagtgggtctgtgtgatgcatgcgcttggagacagaacacgaaatcttcaagaatagaagctata
                       chicken  tgaaaaagacggactgtgcaatgcttgtacgtggagacagaatacaaaatcctccagaatagaagccata
                  MonkParakeet  tgaaaaagacggactgtgcaatgcttgtacgtggagacagaatacaaaatcctccagaatagaagccata
                    HouseMouse  ggaaaaagaggggctgtgtaatgcatgtgcgtggagacaaaacacgaggtactccagaatagaagccata
              ChineseTreeShrew  ggaaaaagaagggctgtgtaatgcatgtacttggagacaaaacactaaatcttcaagaatagaagccata
                    RockPigeon  cgaaaaagatggactatgcaatgcttgtacgtggagacagaatacaaaatcttccagaatagaagccata
            TropicalClawedFrog  -gacaaagatacattgtgcagtgcttgtatctggagacagaacagtaaatctacaaggcttgaagctata
                        Alpaca  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcttcaagactagaagctata
             WildBactrianCamel  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcttcaagactagaagctata
                  ArabianCamel  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcttcaagactagaagctata
                           Dog  ggaaaaggaggggctgtgtaatgcatgtatgtggaggcaaaacactaagtcttcaaggatagaagccata
                    Coelacanth  ggagcaggaaggacgatgtcctgcctgtgactgga---aagacgacagagcctttaggttggaatcgatt
                    MinkeWhale  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcctcaagactagaagccata
                   KillerWhale  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaatactaaatcctcaagactagaagccata
                    SpermWhale  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcctcaagactagaagccata
                ChacoanPeccary  ggaaaaagaggggctgtgtaatgcatgtatgtggagacaaaacactaaatcttcaagactagaagccata

     Oar_rambouillet_v1_0_addY  aaaatccaaatcctcagtaagcttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                        Rabbit  aagattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                GreenSeaTurtle  aaaattcaaatcctcagcaaacttcgtctggaacaagctcctaatattagcagggatactataaaacagc
                         Horse  aaaattcaaatcctcagtaaactgcgcctggaaacagctcctaacatcagcaaagatgctattagacaac
               ChinesePangolin  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctgtaagacaac
                         Human  aagatacaaatcctcagtaaacttcgtctggaaacagctcctaacatcagcaaagatgttataagacaac
                      Aardvark  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                     BlueWhale  aaaatccaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
       CommonBottlenoseDolphin  aaaatccaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                   BelugaWhale  aaaatccaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagacgctataagacaac
                           Pig  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacattagcaaagatgctataagacaac
                FloridaManatee  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                       Tuatara  aaaattcagatccttagcaaactccgtctggaacaagctcctaatattagcagggatgctataaaccagc
           GreaterHorseshoeBat  aaaattcaaatcctcagtaaacttcgtctggaaacagctcccaacattagcaaagatgctataagacaac
       WesternEuropeanHedgehog  aaaattcaaatcctcagcaaactgcgtctggaaacagctccaaacatcagcaaagaagctataagacaac
                       chicken  aaaattcaaatcctcagcaaactgcggctggaacaagcacctaacattagcagggacgttattaaacagc
                  MonkParakeet  aaaattcaaatcctcagcaaactgcgcctggaacaagctcctaatattagcagggatgttattaaacaac
                    HouseMouse  aaaattcaaatcctcagtaagctgcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
              ChineseTreeShrew  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                    RockPigeon  aagattcaaatcctcagcaaactgcgcctggaacaagctcctaacattagcagggatcttattaaacaac
            TropicalClawedFrog  aaaacccagatccttagcaaacttcgactggaacaggcacctaatattagcaaggatgctataaaacacc
                        Alpaca  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
             WildBactrianCamel  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                  ArabianCamel  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                           Dog  aaaattcaaatcctcagcaaacttcgcctggaaacggctcccaacatcagcagagatgctgtcagacaac
                    Coelacanth  aaatcgcaaattctcagcaaactgcgtctagagcagcccccaaacattagtcgggataccgtcaaagagc
                    MinkeWhale  aaaatccaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                   KillerWhale  aaaatccaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                    SpermWhale  aaaatccaaatcctcagtaaacttcgcctggaaacagctcctaacatcagcaaagatgctataagacaac
                ChacoanPeccary  aaaattcaaatcctcagtaaacttcgcctggaaacagctcctaacattagcaaagatgctataagacaac

     Oar_rambouillet_v1_0_addY  ttttgcccaaggctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagcga
                        Rabbit  ttttacccaaagctcctccactccgggaactgattgatcagtacgacgttcagagggatgacagcagtga
                GreenSeaTurtle  ttttacccaaagctcctccattgcaagaactgattgatcagtatgacgtccagagagatgacagcagtga
                         Horse  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
               ChinesePangolin  ttttgcccaaagcgcccccactccgggaactgattgatcagtacgacgtccagagagatgacagcagtga
                         Human  ttttacccaaagctcctccactccgggaactgattgatcagtatgatgtccagagggatgacagcagcga
                      Aardvark  ttttacccaaagctccaccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                     BlueWhale  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
       CommonBottlenoseDolphin  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                   BelugaWhale  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                           Pig  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                FloridaManatee  ttttacccaaagctccgccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                       Tuatara  ttttacccaaagctcctccacttcaggaactcattgatcagtatgatatccagagagatgacagcagtga
           GreaterHorseshoeBat  ttttgcccaaagcccctccgctccgggaactgattgatcagtacgatgtccagcgagatgacagcagtga
       WesternEuropeanHedgehog  ttttgcccaaagctccaccgctccgggaactgattgatcagtacgacgtccagagagatgacagcagcga
                       chicken  ttttacccaaagctcctccactgcaggaactgattgatcagtatgatgtccagagggacgacagtagcga
                  MonkParakeet  ttttacccaaagctcctccactccaggaactgattgatcagtatgacgtccagagagatgacagtagtga
                    HouseMouse  ttctgccaagagcgcctccactccgggaactgatcgatcagtacgacgtccagagggatgacagcagtga
              ChineseTreeShrew  ttttacccaaagctcctccactccgggaactgattgatcagtacgacgtccagagggatgacagcagtga
                    RockPigeon  ttttacccaaagctcctccgctacaggaattgattgatcagtatgacgtccagagagacgatagtagcga
            TropicalClawedFrog  ttttacccaaagcaccacctttacaagatttaatagacaaatatgatgttcaaaaagatgaaagcagtgc
                        Alpaca  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
             WildBactrianCamel  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                  ArabianCamel  ttttgcccaaagctcctccgctccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                           Dog  tcttgccgcgggctcctccgctgcgggagctgatcgaccagtacgacgtccagagggatgacagcagcga
                    Coelacanth  tcctgcctaaagcacctccactgcaagaactgattgatcagtatgacgtccagaaggatgatagcaatga
                    MinkeWhale  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                   KillerWhale  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                    SpermWhale  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga
                ChacoanPeccary  ttttgcccaaagctcctccactccgggaactgattgatcagtacgatgtccagagagatgacagcagtga

     Oar_rambouillet_v1_0_addY  cggctccttggaagacgatgactaccacgttacgacggaaacggtcattaccatgcccacggagtgtgag
                        Rabbit  tggctctttggaagatgacgattatcacgctacgacggaaacaatcattactatgcctaccgagtgtaag
                GreenSeaTurtle  tggttctttggaagatgatgattatcatgctacaactgagactattattacaatgcctacagagtgtaag
                         Horse  tggctctttggaagatgatgattaccacgcgacgacggaaacaatcattaccatgcctacagagtgtaag
               ChinesePangolin  gggctctctggaagacgacgactaccacgccacgacagaaacgatcattactatgcccacagagtgtaag
                         Human  tggctctttggaagatgacgattatcacgctacaacggaaacaatcattaccatgcctacagagtgtaag
                      Aardvark  tggttctttggaagatgatgattatcacgctacgacggaaacaattattacgatgcctacagagtgtaag
                     BlueWhale  cggctccttggaagatgatgattaccacgctacgacggaaacggtcattaccatgcccacagagtgtgag
       CommonBottlenoseDolphin  cggctccttggaagatgatgattaccacgctacgacggaaacggtcattaccatgcccacagagtgtgag
                   BelugaWhale  cggctccttggaagatgatgattaccacgctacgacggaaacggtcattaccatgcccacagagtgtgag
                           Pig  tggctccttggaagatgatgattatcacgctacgacggaaacgatcattaccatgcctacagagtgtaag
                FloridaManatee  tgggtctttggaagatgatgattatcacgctacgacagaaacaattattactatacctacagagtgtaag
                       Tuatara  tggttctttggaagatgatgattatcatgctacaactgaaaccattattacaatgcctacagaacgtaag
           GreaterHorseshoeBat  tggctccttggaagatgatgattaccatgctacgacagaaacgatcattaccatgcctacagagtgtaag
       WesternEuropeanHedgehog  tggctccttggaagatgatgattatcacgctacaacggagactatcattaccatgcctacggagtgtaag
                       chicken  tggctctttggaagacgatgactatcatgccacaaccgagacgattatcacaatgcctacggagtgtaag
                  MonkParakeet  tggctctttggaagacgatgactatcatgccaccaccgaaacgattatcacaatgcctacagagtgtaag
                    HouseMouse  tggctctttggaagatgacgattatcacgctaccacggaaacaatcattaccatgcctacagagtgtaag
              ChineseTreeShrew  tggttctctggaagatgacgattatcatgctaccacggaaacgatcattactatgcctacagagtgtaag
                    RockPigeon  tggctctttggaagacgatgactatcatgccaccaccgaaacgataatcacaatgccgacggagtgtaag
            TropicalClawedFrog  tggtcatttggaagaggatgattatcatgtctctgctgaaactgttattataatgcctaccgagtgtaag
                        Alpaca  cggctccttggaagatgatgattaccacgctacgacggaaacgatcattaccatgcctacagagtgtaag
             WildBactrianCamel  tggctccttggaagatgatgattaccacgctacgacggaaacaatcattaccatgcctacagagtgtaag
                  ArabianCamel  tggctccttggaagatgatgattaccacgctacgacggaaacaatcattaccatgcctacagagtgtaag
                           Dog  cggctccctggaggacgacgactaccacgccaccaccgagacggtcattgccatgcccgccgagagtgag
                    Coelacanth  gggatctttggaagatgacgattaccatgccacaacagaaactgttattaccatggccacagagcgtaag
                    MinkeWhale  cggctccttggaagatgatgattaccacgctacaacggaaacggtcattaccatgcccacagagtgtgag
                   KillerWhale  cggctccttggaagatgatgattaccacgctacgacggaaacggtcattaccatgcccacagagtgtgag
                    SpermWhale  cggctccttggaagatgatgattaccacgctacgacggaaacggtcattaccatgcccacagagtgtgag
                ChacoanPeccary  tggctccttggaagatgatgattatcacgctacgacggaaacgatcattaccatgcctacagagtgtaag

     Oar_rambouillet_v1_0_addY  t---agttctgcta
                        Rabbit  t---agtcctatta
                GreenSeaTurtle  t---agtcctgcta
                         Horse  t---agtcctgtta
               ChinesePangolin  t---agaactgcta
                         Human  t---agtcctatta
                      Aardvark  t---agtcttatta
                     BlueWhale  t---agtcctatta
       CommonBottlenoseDolphin  t---agtcctatta
                   BelugaWhale  t---agtcctatta
                           Pig  t---agtcctatta
                FloridaManatee  t---aatcctgtta
                       Tuatara  t---agtcctgcta
           GreaterHorseshoeBat  t---agtcctatta
       WesternEuropeanHedgehog  t---agtcctatga
                       chicken  taacaaccctgctg
                  MonkParakeet  t---aaccctgctg
                    HouseMouse  t---atatctgtta
              ChineseTreeShrew  t---agtcctgtta
                    RockPigeon  t---aaccccactg
            TropicalClawedFrog  t---tgt-------
                        Alpaca  t---agtcctatta
             WildBactrianCamel  t---agtcctatta
                  ArabianCamel  t---agtcctatta
                           Dog  t---agc----tgg
                    Coelacanth  t---a---------
                    MinkeWhale  t---agtcctatta
                   KillerWhale  t---agtcctatta
                    SpermWhale  t---agtcctatta
                ChacoanPeccary  t---agtcctatta

Alignment block 6 of 177 in window, 129060144 - 129060261, 118 bps 
B D  Oar_rambouillet_v1_0_addY  g--ggc-agagca-acgactctgct--g----actgctgttctagtgttcatgagaaaccgatct-attt
                        Rabbit  g--tgt-atgtca-acagttctgct--g----actgttgttctagtgtttatgggaaacagatct-attt
                GreenSeaTurtle  c--tttaatatcacactattctact--gataaacagttgtcctagtgcttaagagcaacaaatct-tgtc
                         Horse  g--tgt-atatca-acaattctgct--g----actgttgttctagtgtttatgagaaacagatct-attt
               ChinesePangolin  g--tgt-atat----cgattctgct--g----actgttgttctagtgtttatgagaaacatatct-actt
                         Human  g--tgt-atatca-acagttctgct--g----actgttgttctagtgtttatgagaaacagatct-attt
                      Aardvark  ---tgt-atatcg-gcagttctgct--g----actgttgttctagtgtttatgagaaacagatca-attt
                     BlueWhale  g--tgt-agagca-acagttctgct--g----actgctgttctagtgtttatgagaaaccgatct-attt
       CommonBottlenoseDolphin  g--tgt-agagca-acagttctgct--g----actgttgttctagtgtttatgagaaaccgatct-attt
                   BelugaWhale  g--tgt-agagca-acagttctgct--g----actgttgttctagtgtttatgagaaaccgatct-attt
                           Pig  g--tgt-atatca-acaattctgct--g----actgttgttccagtgtttatgagaaacagatct-attt
                FloridaManatee  c---gt-atatca-gcaattctgct--g----actgttgttctaatgtttatgagaaacagatct-attc
                       Tuatara  ctttat-atgcca--ctattctact--gacaaacagttgtcttagtgcttaagggcaacagg--------
           GreaterHorseshoeBat  ----gt-atagca-acaattctgcc--g----ac---cggtctagtgtttatgagaaacagatct-attt
       WesternEuropeanHedgehog  ----gt-atatca-acaattctgct--g----actgttgttctagtgtttacgagaaacagatct-attt
B                      chicken  t--cgt-ctcgca-ccgctcct-ct--g----agagttgtctctgtgctgtagagcctcacaactccttc
                  MonkParakeet  t--cgc-ctccca-ccactcct-ccgag----agagttctctctctgctgtagagccactcaactcctcc
                    HouseMouse  a--agt-atatca-acagttctgct--g----actgctgtcctagtgtttatgagaaacagatct-attt
              ChineseTreeShrew  g--tgt-atatca-acagttctgct--g----actgttggtctagtgtttatgagaaacagatct-attt
                        Alpaca  g--tgt-atatca-acaattctgct--g----actgttgttccagtgtttatgagaaacagatct-attt
             WildBactrianCamel  g--tgt-atatca-acaattctgct--g----actgttgttctagtgtttatgagaaacagatct-attt
                  ArabianCamel  g--tgt-atatca-acaattctgct--g----actgttgttctagtgtttatgagaaacagatct-attt
                           Dog  g--tgt-gtggc-----------------------gcggggctcgtgtcggtggcagctgg--------t
                    MinkeWhale  g--tgt-agagca-acagttctgct--g----actgctgttctagtgtttatgagaaaccgatct-attt
                   KillerWhale  g--tgt-agagcg-acagttctgct--g----actgttgttctagtgtttatgagaaaccgatct-attt
                    SpermWhale  g--tgt-agagca-acagttctgct--g----actgttgttctagtgtttatgagaaaccgatct-attt
                ChacoanPeccary  g--tgt-atatca-acaattctgct--g----actgttgttccagtgtttatgagaaacagatct-attt

     Oar_rambouillet_v1_0_addY  tcaggctctttt-aacaagctgctggct--t--gtacgt-aaggaggagggcaaagagc------tt---
                        Rabbit  tcaggctctttt-aataagctgtcagct--t--ttatgt-aagaagcaggaaagacagtctc--ttc---
                GreenSeaTurtle  tcagtctcttct-aacaggctgctggca--gaagtatgt-aagagggagggagaagaacata--ttt---
                         Horse  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagcaggaaggaaaagagtttc--ttt---
               ChinesePangolin  tcaggctctttt-aacaagctgctagct--t--ttatgt-aagtaggaaggaaaagagtttc--ttt---
                         Human  tcaggctcttttaaacaagctgttggcc--t--gtatgt-aagtagaaaggaaaagagtttc--tct---
                      Aardvark  tcaggctctttt-aacaagctgttggct--t--gtatat-aagcag-gaggaaaggtttttt--ttt---
                     BlueWhale  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagtttcttttt---
       CommonBottlenoseDolphin  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagtttc-tttt---
                   BelugaWhale  tcaggctctttt-aacaagctgttggct--t--gtattt-aagtaggagggaaaagagtttc-tttt---
                           Pig  tcaggctctttt-aacaagctgttggct--t--gtacgt-aagtaggagggaaaagagtttc---tt---
                FloridaManatee  tcaggctcttta-aacaagctgttggct--t--gtatgt-aagcagaaggaaagggtttctt--ttt---
                       Tuatara  -cagtctcttct-aacaagatgctggct--gaagtctgg-aagagggagggagaagagtata--ttt---
           GreaterHorseshoeBat  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagg------tt---
       WesternEuropeanHedgehog  tcaggctctttt-aacaagctgttggct--a--ctatataaagtaggaggggaaa-agc------ttccc
                       chicken  tcaggctctccc-aacaggctgctggctgga--gtctgc-cggagggagggaggagag------------
                  MonkParakeet  tcgggctctccc-aacaggctgctggctgaa--gtctgc-tggagggagggaggagag------------
                    HouseMouse  tcagg--ctttt-aacaagctgttggct--t--atatgt-aagtagcagagaaaggaga------tt---
              ChineseTreeShrew  tcaggctctttt-aacaagctgttggct--t--gtatat-agataggaggaaaaagagt------tt---
                        Alpaca  tcaggctctttt-aacaggctgttcgcg--t--gtatgt-aagtaggagggaaaagagt------tt---
             WildBactrianCamel  tcaggctctttt-aacaggctgttcgtg--t--gtatgt-aagtaggagggaaaagagt------tt---
                  ArabianCamel  tcaggctctttt-aacaggctgttcgtg--t--gtatgt-aagtaggagggaaaagagt------tt---
                           Dog  ccgggctccctt-cccaggccgccgccg--t--g--tgg-gagtgggaagg--aggatc------tc---
                    MinkeWhale  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagt------tt---
                   KillerWhale  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagt------tt---
                    SpermWhale  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagt------tt---
                ChacoanPeccary  tcaggctctttt-aacaagctgttggct--t--gtatgt-aagtaggagggaaaagagt------tt---

     Oar_rambouillet_v1_0_addY  ------t--tt--------g
                        Rabbit  ------t--tt--------t
                GreenSeaTurtle  ------t--ta---------
                         Horse  ------t--tt--------t
               ChinesePangolin  ------t--tc--------c
                         Human  ------t--tt--------t
                      Aardvark  ------t--ttttttttggt
                     BlueWhale  ------t--tt--------t
       CommonBottlenoseDolphin  ------t--tt--------t
                   BelugaWhale  ------t--tt--------t
                           Pig  ------t--tt--------t
                FloridaManatee  ------t--tt--------t
                       Tuatara  ------t-------------
           GreaterHorseshoeBat  ------t--gt--------t
       WesternEuropeanHedgehog  acctccc--ag--------c
                       chicken  ------t--gt--------a
                  MonkParakeet  ------c--at--------t
                    HouseMouse  ------t--tt--------t
              ChineseTreeShrew  ------c--tt--------t
                        Alpaca  ------c--tt--------t
             WildBactrianCamel  ------c--at--------t
                  ArabianCamel  ------c--at--------t
                           Dog  ------t--gt--------c
                    MinkeWhale  ------ctttt--------t
                   KillerWhale  ------ctttt--------t
                    SpermWhale  ------ctttt--------t
                ChacoanPeccary  ------c--tt--------t

Alignment block 7 of 177 in window, 129060183 - 129060255, 73 bps 
B D  Oar_rambouillet_v1_0_addY  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                 JavaMouseDeer  catgagaaaccgatctattttcaggctcttttaacaagctgttggcttgtctgtaagtaggaggg-aaaa
                         Saiga  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtaaggaggaggg-caaa
                         Gayal  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                    LesserKudu  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                     Sitatunga  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                 MountainNyala  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
               LesserMouseDeer  catgagaaaccgatctattttcaggctcttttaacaagctgttggcttgtctgtaagtaggagggaaaaa
                AlpineMuskDeer  tatgagaaaccgatctattttcagtctcttttaacaagctgctggcttgtatgtacgtaggaggg--aaa
                WesternRoeDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtgtgtaagcaggaggg-aaaa
                          Gaur  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                 AmericanBison  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaga
                       WildYak  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                   DomesticYak  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                  WaterBuffalo  catgagaaaccggtctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                AfricanBuffalo  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                   CommonEland  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                   GreaterKudu  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                      Bushbuck  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                        Impala  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtgaggaggaggg-caaa
                          Suni  catgagaaaccgatctattttcaggcacttttaacaagctgctggcttgtacgtgaggaggaggg-caaa
                  Klipspringer  catgagaaaccgatctattttcaggctcttttaacaggctgctggcttgcacgtaaggaggaggg-caaa
                 RoyalAntelope  catgagaaaccgatctattttcaggttcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                   KirksDikDik  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtaaggaggaggg-caaa
            PrzewalskisGazelle  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtaaggaggaggg-caaa
                         Oribi  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtctgtaaggaagaggg-caaa
               ThomsonsGazelle  catgagaagccgatctattttcaggctcttttaacaagctgccggcttgtccgtaaggaggaggg-caag
                 GrantsGazelle  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtaaggaggaggg-caaa
                       Gerenuk  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtaaggaggaggg-caaa
                     Springbok  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtccgtaaggaggaggg-cata
                MaxwellsDuiker  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                 HarveysDuiker  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                 BohorReedbuck  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgcacgtaaggaggaggg-caaa
              DefassaWaterbuck  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgcacgtaaggaggaggg-caaa
                        Lechwe  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgcacgtaaggaggaggg-caaa
                       Gemsbok  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
            ScimitarHornedOryx  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                  RoanAntelope  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                 SableAntelope  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                BlueWildebeest  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                          Topi  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacataaggaggaggg-caaa
                        Herola  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
               TibetanAntelope  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                  MountainGoat  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
               EuropeanMouflon  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                AsiaticMouflon  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                     SnowSheep  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                  BighornSheep  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                  BarbarySheep  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                        Bharal  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                   NilgiriTahr  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
B D                       ARS1  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                      WildGoat  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
                  SiberianIbex  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaaggaggaggg-caaa
         ChineseForestMuskDeer  tatgagaaaccgatctattttcagtctcttttaacaagctgctggcttgtatgtacgtaggaggg--aaa
                  BlackMuntjac  tatgagaaaccgatctattttcaggctcttttaacaagctgctggctt-tatgtaagcagaggga--aaa
                 IndianMuntjac  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggaggg-aaaa
                 ReevesMuntjac  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtacgtaagcaggaggg-aaaa
                PereDavidsDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggaggg-aaaa
               WhiteLippedDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggagggaaaaa
                   YarkandDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggagggaaaaa
                       RedDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggagggaaaaa
                       HogDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggaggg-aaaa
               WhiteTailedDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgcatgtaagcaggaggg-aaaa
                      MuleDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgcatgtaagcaggaggg-aaaa
                      Reindeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgcatgtaagcaggaggg-aaaa
                EasternRoeDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtgtgtaagcaggaggg-aaaa
                   EurasianElk  tatgagaaaccgatctattttcaggctctttcaacaagctgctggcttgtatgtaagcaggaggg-aaaa
              ChineseWaterDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagcaggaggg-aaaa
                       Giraffe  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagtaggaggg-aaaa
                     Pronghorn  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagtaggaggg-aaaa
                        Cattle  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
                    ZebuCattle  catgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaaggaggaggg-gaaa
              SiberianMuskDeer  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagtaggaggg--aaa
                         Okapi  tatgagaaaccgatctattttcaggctcttttaacaagctgctggcttgtatgtaagtaggaggg-aaaa

     Oar_rambouillet_v1_0_addY  gagc
                 JavaMouseDeer  aagg
                         Saiga  gagc
                         Gayal  gagc
                    LesserKudu  gagc
                     Sitatunga  gagc
                 MountainNyala  gagc
               LesserMouseDeer  aggt
                AlpineMuskDeer  gagc
                WesternRoeDeer  gagc
                          Gaur  gagc
                 AmericanBison  gagc
                       WildYak  gagc
                   DomesticYak  gagc
                  WaterBuffalo  gagc
                AfricanBuffalo  gagc
                   CommonEland  gagc
                   GreaterKudu  gagc
                      Bushbuck  gagc
                        Impala  gagc
                          Suni  gagc
                  Klipspringer  gctc
                 RoyalAntelope  gagc
                   KirksDikDik  gagc
            PrzewalskisGazelle  gagc
                         Oribi  gagc
               ThomsonsGazelle  gagc
                 GrantsGazelle  gagc
                       Gerenuk  gagc
                     Springbok  gagc
                MaxwellsDuiker  gagc
                 HarveysDuiker  gagc
                 BohorReedbuck  gagc
              DefassaWaterbuck  gagc
                        Lechwe  gagc
                       Gemsbok  gagc
            ScimitarHornedOryx  gagc
                  RoanAntelope  gagc
                 SableAntelope  gagc
                BlueWildebeest  gagc
                          Topi  gagc
                        Herola  gagc
               TibetanAntelope  gagc
                  MountainGoat  gagc
               EuropeanMouflon  gagc
                AsiaticMouflon  gagc
                     SnowSheep  gagc
                  BighornSheep  gagc
                  BarbarySheep  gagc
                        Bharal  gagc
                   NilgiriTahr  gagc
                          ARS1  gagc
                      WildGoat  gagc
                  SiberianIbex  gagc
         ChineseForestMuskDeer  gagc
                  BlackMuntjac  gagc
                 IndianMuntjac  gagc
                 ReevesMuntjac  gagc
                PereDavidsDeer  gagc
               WhiteLippedDeer  gagc
                   YarkandDeer  gagc
                       RedDeer  gagc
                       HogDeer  gagc
               WhiteTailedDeer  gagc
                      MuleDeer  gagc
                      Reindeer  gagc
                EasternRoeDeer  gagc
                   EurasianElk  gagc
              ChineseWaterDeer  gagc
                       Giraffe  gagc
                     Pronghorn  gagc
                        Cattle  gagc
                    ZebuCattle  gagc
              SiberianMuskDeer  gagc
                         Okapi  gagc

Alignment block 8 of 177 in window, 129060256 - 129060288, 33 bps 
B D  Oar_rambouillet_v1_0_addY  tttttgcaagacttcatgagaaatatgctaatg
                 JavaMouseDeer  ttttttcaagatttcacgagaaataggctaatg
                         Bongo  ttttttcaagatttcatgagaaatataccaatg
                         Saiga  ttttttcaagatttcatgagaaatatactaata
                         Gayal  ttttttcaagatttcatgagaaatagaccaatg
                    LesserKudu  ttttttcaagatttcatgagaaatataccaatg
                     Sitatunga  ttttttcaagatttcatgagaaatataccaatg
                 MountainNyala  ttttttcaagatttcatgagaaatataccaatg
               LesserMouseDeer  ttttttcaagatttcacgagaaataggctaatg
                AlpineMuskDeer  ttttttcaagatttcatgagaaatatattaatg
                WesternRoeDeer  ttctttcaagatttcctgagaaatatactaagg
                          Gaur  ttttttcaagatttcatgagaaatagaccaatg
                 AmericanBison  ttttttcaagatttcatgagaaatagaccaatg
                       WildYak  ttttttcaagatttcatgagaaatagaccaatg
                   DomesticYak  ttttttcaagatttcatgagaaatagaccaatg
                  WaterBuffalo  ttttttcaagatttcatgagaaatagaccaatg
                AfricanBuffalo  ttttttcaagatttcatgagaaatagaccaatg
                   CommonEland  ttttttcaagatttcatgagaaatataccaatg
                   GreaterKudu  ttttttcaagatttcatgagaaatataccaatg
                      Bushbuck  ttttttcaagatttcatgagaaatataccaatg
                        Impala  ttttttcaagatttcatgagaaatatactaatg
                          Suni  ttttttcaagatttcatgagaaatatactaatg
                  Klipspringer  ttttttcaagacttcacgagaaatgtactaatg
                 RoyalAntelope  ttttttcaagacttcatgagaaatatactaatg
                   KirksDikDik  ttttttcaagatttcatgagaaatatactaatg
            PrzewalskisGazelle  ttttctcaagatttcatgggaaatatactaatg
                         Oribi  ttttttcaagatttcatgagaaatatactaatg
               ThomsonsGazelle  ttttttcaagatttcatgagaaatatactaatg
                 GrantsGazelle  ttttttcaagatttcatgagaaatatactaatg
                       Gerenuk  ttttttcaagatttcatgagaaatatactaatg
                     Springbok  ttttttcaagatttcatgagaaatatactaatg
                MaxwellsDuiker  ttttttcaagacttcatgagaaatatactaatg
                 HarveysDuiker  ttttttcaagacttcgtgagaaatatactaatg
                 BohorReedbuck  ttttt-caagatttcatgagaaatagactaatg
              DefassaWaterbuck  ttttt-caagatttcatgagaaatagactaatg
                        Lechwe  ttttt-caagatttcatgagaaatagactaatg
                       Gemsbok  tttttgcaagacttcatgagaaatatactaatg
            ScimitarHornedOryx  tttttgcaagacttcatgagaaatatactaatg
                  RoanAntelope  tttttgcaagacttcatgagaaatatactgatg
                 SableAntelope  tttttgcaagacttcatgagaaatatactgatg
                BlueWildebeest  tttttgcaagacttcatgagaaatatactgatg
                          Topi  tttttgcaagacttcatgagaaatatactaatg
                        Herola  tttttgcaagacttcatgagaaatatactaatg
               TibetanAntelope  tttttgcaagacttcatgagaaatatactaatg
                  MountainGoat  tttttgcaagacttcatgagaaatatgctaatg
               EuropeanMouflon  tttttgcaagacttcatgagaaatatgctaatg
                AsiaticMouflon  tttttgcaagacttcatgagaaatatgctaatg
                     SnowSheep  tttttgcaagacttcatgagaaatatgctaatg
                  BighornSheep  tttttgcaagacttcatgagaaatatgctaatg
                  BarbarySheep  tttttgcaagacttcacgagaaatatgctaatg
                        Bharal  tttttgcaagacttcatgagaaatatgctaatg
                   NilgiriTahr  tttttgcaagacttcatgagaaatatgctaatg
B D                       ARS1  tttttgcaagacttcatgagaaatatgctaatg
                      WildGoat  tttttgcaagacttcatgagaaatatgctaata
                  SiberianIbex  tttttgcaagacttcatgagaaatatgctaatg
         ChineseForestMuskDeer  ttttt-caagatttcatgagaaatatactaatg
                  BlackMuntjac  tcttt-caagatttcctgagaaatatactaatg
                 IndianMuntjac  ttctttcaagatttcctgagaaatatactaatg
                 ReevesMuntjac  ttctttcaagatttcctgagaaatatactaatg
                PereDavidsDeer  ttctttcaagatttcctgagaaatatactaatg
               WhiteLippedDeer  ttctttcaagatttcctgagaaatatactaatg
                   YarkandDeer  ttctttcaagatttcctgagaaatatactaatg
                       RedDeer  ttctttcaagatttcctgagaaatatactaatg
                       HogDeer  ttctttcaagatttcctgagaaatatactaatg
               WhiteTailedDeer  ttctttcaagatttcctgagaaatatactaatg
                      MuleDeer  ttctttcaagatttcctgagaaatatactaatg
                      Reindeer  ttctttcaagatttcctgagaaatatactaatg
                EasternRoeDeer  ttctttcaagatttcctgagaaatatactaagg
                   EurasianElk  ttctttcaagatttcctgagaaatatactaacg
              ChineseWaterDeer  ttctttcaagatttcctgagaaatatactaatg
                       Giraffe  ttttttcaagatttcatgagaaatatactaatg
                     Pronghorn  ttttctcgagatttcatgagcaataccctaacg
                        Cattle  ttttttcaagatttcatgagaaatagaccaatg
                    ZebuCattle  ttttttcaagatttcatgagaaatagaccaatg
              SiberianMuskDeer  ttttttcaagatttcatgagaaatatactaatg
                         Okapi  ttttttcaagatttcatgagaaatatactaatg

Alignment block 9 of 177 in window, 129060262 - 129060311, 50 bps 
B D  Oar_rambouillet_v1_0_addY  caagacttcatgag---aaatatgctaatga---gactgaaagctgctacattatc
                        Rabbit  caagattttgtgag---aaata---tgttga---aactgaaatctgtcacactgtc
                         Horse  caagatttcatgag---aaatttactaatga---gactgaaatctgctgcattatt
               ChinesePangolin  caggatttcacgag---gaa-ttactagcaa---gactgaaatctgctgcacaatt
                         Human  caagattgcatgag----aatatattaatga---gacaaaaatctgctgcattatt
                      Aardvark  ctatatttcatgag---aaatgcaataatga---gat-tgaatctgctgcattatt
                     BlueWhale  caagatttcgtgag---aaatatactaatga---gactgaaagctgctgcataatt
       CommonBottlenoseDolphin  cgagatttcatgag---aaatatactaatga---gactgaaagctgctgcataatt
                   BelugaWhale  caagatttcatgag---aaatatactaatga---gactgaaagctgctgcatactt
                           Pig  caagatttcatgag---aaataaactaatga---gactgaaagctgctgtattatt
                FloridaManatee  caatatttcataag---aaata---taatga---gattgaaatctgctgcattatt
           GreaterHorseshoeBat  caagatttcatgag---aaaagtattaatga---gactaa----------------
       WesternEuropeanHedgehog  caacatttcatgag---aaatagactaacga---gactgaaatgtgctatagtttt
                    HouseMouse  caagatttcctgag---aaacataccgac------aatgaaatctgtc---ttgct
              ChineseTreeShrew  aaaaaacttatgag---tgataaactaattt---gattgaaatctgctgcattatt
                        Alpaca  caagatttcatcag---aaat---ctaatga---gactgagagctgctgcattata
             WildBactrianCamel  caagatttcatgag---aaat---ctaatga---gactgagagctgctgcattata
                  ArabianCamel  caagatttcatgag---aaat---ctaatga---gactgagagctgctgcattata
                           Dog  caagatgtcacggagctgagc---tgaagga---cgcaggaagctgcggcaccatc
                    MinkeWhale  caagatttcatgag---aaatatactaatga---gactgaaagctgctgcataatt
                   KillerWhale  cgagatttcatgag---aaatatactaatga---gactgaaagctgctgcataatt
                    SpermWhale  caagatttcatgag---aaatatactaatga---gactgaaagctgctgcataatt
                ChacoanPeccary  caagatttcatgag---aaataaactaatga---gactgaaagctgctgcattact
                GreenSeaTurtle  ---aataatttgaa---tcatcatccaatgacctcactgtgatcttttattttatt

Alignment block 10 of 177 in window, 129060289 - 129060314, 26 bps 
B D  Oar_rambouillet_v1_0_addY  agactgaaagctgctacattatctgt
                 JavaMouseDeer  agacagaaagctgctgcagtgtttgt
                         Bongo  agactgaaagctgctacattatttgt
                         Saiga  agactgaaagctgctacgttatttgt
                         Gayal  agactgaaagctactactttatttgt
                    LesserKudu  agactgaaagctgctacattatttgt
                     Sitatunga  agactgaaagctgctacattatttgt
                 MountainNyala  agactgaaagctgctacattatttgt
               LesserMouseDeer  agacagaaagctgctgcagtgtttgt
                AlpineMuskDeer  agactgaaagctgctacattatttgt
                WesternRoeDeer  agactgaaagctgctaca----ttgt
                          Gaur  agactgaaagctactactttatttgt
                 AmericanBison  agactgaaagctgctactttatttgt
                       WildYak  agactgaaagctgctactttatttgt
                   DomesticYak  agactgaaagctgctactttatttgt
                  WaterBuffalo  agactgaaagctgccacattatttgt
                AfricanBuffalo  agactgaaagctgctacattatttgt
                   CommonEland  agactgaaagctgctacattatttgt
                   GreaterKudu  agactgaaagctgctacattatttgt
                      Bushbuck  agactgaaagctgctacattatttgt
                        Impala  agactgaaaggggctacattatttat
                          Suni  agactgaaagctgctacattatttgt
                  Klipspringer  agactgaaagctgctacattatctgt
                 RoyalAntelope  agactgaaagctgctacattatctgt
                   KirksDikDik  agactgaaagctgctacattatttgt
            PrzewalskisGazelle  agactgaaagctgctacattatttgt
                         Oribi  agactgaaagctgctacattatctgt
               ThomsonsGazelle  agactgaaagctgctacgttatttgt
                       Gerenuk  agactgaaagctgctacgttatttgt
                     Springbok  agactgaaagctgctacgttatttgt
                MaxwellsDuiker  agactgaaagctgctacgttatctgt
                 HarveysDuiker  agactgaaagctgctacgttatctgt
                 BohorReedbuck  agactgaaagctgctacattatttgt
              DefassaWaterbuck  agactgaaagctgctacattatttgt
                        Lechwe  agactgaaagctcctacattatttgt
                       Gemsbok  agactgaaagctgctacattatctgt
            ScimitarHornedOryx  agactgaaagctgctacattatctgt
                  RoanAntelope  agactgaaagctgctacattatctgt
                 SableAntelope  agactgaaagctgctacattatctgt
                BlueWildebeest  agactgaaagctgctacattatctgt
                          Topi  agactgaaagctgctacattatctgt
                        Herola  agactgaaagctgctacattatctgt
               TibetanAntelope  agactgaaagctgctacattatctgt
                  MountainGoat  agactgaaagctgctacattatctgt
               EuropeanMouflon  agactgaaagctgctacattatctgt
                AsiaticMouflon  agactgaaagctgctacattatctgt
                     SnowSheep  agactgaaagctgctacattatctgt
                  BighornSheep  agactgaaagctgctacattatctgt
                  BarbarySheep  agactgaaagctgctacattatctgt
                        Bharal  agactgaaagctgctacattatctgt
                   NilgiriTahr  agactgaaagctgctacattatctgt
B D                       ARS1  agactgaaagctgctacattatctgt
                      WildGoat  agactgaaagctgctacattatctgt
                  SiberianIbex  agactgaaagctgctacattatctgt
         ChineseForestMuskDeer  agactgaaagctgctacattatttgt
                  BlackMuntjac  agactgaaagctgctaca----ttgt
                 IndianMuntjac  agactgaaaactgctaca----ttgt
                 ReevesMuntjac  agactgaaagctgctaca----ttgt
                PereDavidsDeer  agactgaaagctgctaca----ttgt
               WhiteLippedDeer  agactgaaagctgctaca----ttgt
                   YarkandDeer  agactgaaagctgctaca----ttgt
                       RedDeer  agactgaaagctgctaca----ttgt
                       HogDeer  agactgaaagctgctaca----ttgt
               WhiteTailedDeer  agactgaaagctgctcca----ctgt
                      MuleDeer  agactgaaagctgctaca----ctgt
                      Reindeer  agactgaaagctgctaca----ctgt
                EasternRoeDeer  agactgaaagctgctaca----ttgt
                   EurasianElk  aggctgaaagctgctgca----ttgt
              ChineseWaterDeer  agactgaaagctgctaca----ttgt
                       Giraffe  agactgaaagctgctacattatttgt
                     Pronghorn  agactgaaagctgcagcatgatttgt
                        Cattle  agactgaaagctgctactttatttgt
                    ZebuCattle  agactgaaagctgctactttatttgt
              SiberianMuskDeer  agactgaaagctgctacattatttgt
                         Okapi  agactgaaagctgctacattatttgt

Alignment block 11 of 177 in window, 129060312 - 129060374, 63 bps 
B D  Oar_rambouillet_v1_0_addY  tgtttccttagagagctaaaaagctaaaaatc-------ag----aaatgaaatgcttgcatagcattcg
                        Rabbit  tgtttccttaaaaagctaaaaagct------a-------aa----agataaaaagcttgcacagcgttaa
                         Horse  tgttttcttagagagctaaaaagct------a-------aaca--aaataaaattcttgcacagcattaa
               ChinesePangolin  tgtttcggtagagagctaaaaagct------g-------aaaaataaataaaatgcttgcatgggattaa
                         Human  tgttttcttatagagacaaaaaact------a-------aa----aaataaagtacttgcatagca----
                      Aardvark  tatttctttatagagctgggaagct------a-------aa----tattacagagctggtacagcactga
                     BlueWhale  tgtttccttagagagctaaaaagctaaaaata-------aa----aaataaaatgcttgcat--------
       CommonBottlenoseDolphin  tgtttccttagagagctaaaaggct--------------aa----aaataaaatgcttgcatagcattaa
                   BelugaWhale  tgtttccttagagagctaaaaggct--------------aa----aaataaaatgcttgcatagcattaa
                           Pig  gttttcctt----agctaaacagctgaaaata-------aa----aaataaaatgcttgcatagcat---
                FloridaManatee  tgtttctttatggagttagaaagct--------------aa----aaattgaa---ttgcacagcattaa
           GreaterHorseshoeBat  --tttct-----------------------------------------gaaaatgcttgcatagcattaa
       WesternEuropeanHedgehog  ggtttcttttaaaa---agattttttaaaaaaaactaagaa----acataaaatacttgcaaatcattaa
                    HouseMouse  tgtttcctggcagtgccaaatagctcaaagt-----------------taatatgctggctcagctttaa
              ChineseTreeShrew  tgtttctttatggagctcaaatgctaaaaac-----------------taaaacgcctgcacagcattaa
                        Alpaca  tatcccctgagggagctaaaaagctaaaaat--------aa----aaataaaatgcttgtatagcattaa
             WildBactrianCamel  tattccctgagggagctaaaaagctaaaaata-------aa----aaataaaatgcttgcatagcattaa
                  ArabianCamel  tattccctgagggagctaaaaagctaaaaata-------aa----aaataaaatgcttgcatagcattaa
                           Dog  ggcctcgccggagagctcaaaagccaaaaggagat----ga----ggataaaacgcctgcgtggcgctca
                    MinkeWhale  tgtttccttagagagctaaaaagctaaaaata-------aa----aaataaaatgcttgcat--------
                   KillerWhale  tgtttccttagagagctaaaaggct--------------aa----aaataaaatgcttgcatagcattaa
                    SpermWhale  tgtttccttagagagctaagaagctaaaaa------------------taaaatgcttgcatagcattaa
                ChacoanPeccary  gttttcctt----agctaaaaagctgaaaata-------aa----aactaaaatgcctgcatagtattaa

     Oar_rambouillet_v1_0_addY  tgtt
                        Rabbit  tatt
                         Horse  tatt
               ChinesePangolin  tgtt
                         Human  ----
                      Aardvark  cgtt
                     BlueWhale  ----
       CommonBottlenoseDolphin  tgtt
                   BelugaWhale  tgtt
                           Pig  tgtt
                FloridaManatee  cgtt
           GreaterHorseshoeBat  cgtt
       WesternEuropeanHedgehog  tgct
                    HouseMouse  tagt
              ChineseTreeShrew  tggt
                        Alpaca  tatt
             WildBactrianCamel  tatt
                  ArabianCamel  tatt
                           Dog  cgtt
                    MinkeWhale  ----
                   KillerWhale  tgtt
                    SpermWhale  tgtt
                ChacoanPeccary  tgtt

Alignment block 12 of 177 in window, 129060315 - 129060348, 34 bps 
B D  Oar_rambouillet_v1_0_addY  ttccttagagagctaaaaagctaaaaatcagaa-a
                 JavaMouseDeer  ttccttagagagctaaaaagct-aattttgaaa-a
                         Bongo  ttccttagagagctaaaaagctaaaaataaaaa-a
                         Saiga  ttccttagagagctaaaaagctaaaaatcaaaa-a
                         Gayal  ttccttagagagctaaaaagctaaaaatcaaaa-a
                    LesserKudu  ttccttagagagctaaaaagctaaaaataaaaa-a
                     Sitatunga  ttccttagagagctaaaaagctaaaaataaaaa-a
                 MountainNyala  ttccttagagagctaaaaagctaaaaataaaaa-a
               LesserMouseDeer  ttccttagagagctaaaaagct-aattttgaaa-a
                AlpineMuskDeer  ttccttagagagctaaaaagctaaaaataaaaa-a
                WesternRoeDeer  ctccttagagagctaaagagctaaaaataaaaa-a
                          Gaur  ttccttagagagctaaaaagctaaaaatcaaaa-a
                 AmericanBison  ttccttagagagcgaaaaagctaaaaatcaaaa-a
                       WildYak  ttccttagagagctaaaaagctaaaaatcaaaa-a
                   DomesticYak  ttccttagagagctaaaaagctaaaaatcaaaa-a
                  WaterBuffalo  ttccttagagagctaaaaagctaaaaatcaaaa-a
                AfricanBuffalo  ttccttagagagctaaaaagctaaaaatcaaaa-a
                   CommonEland  ttccttagagagctaaaaagctaaaaataaaaa-a
                   GreaterKudu  ttccttagagagctaaaaagctaaaaatataaa-a
                      Bushbuck  ttccttagagagctaaaaagctaaaaataaaaa-a
                        Impala  ttccttagacagctgaaaagctaaaaatcaaaa-a
                          Suni  ttccttagagagctaaaaagctaaaaatcaaaa-a
                  Klipspringer  ttccttagagagctaaaaagctaaaaatcaaaa-a
                   KirksDikDik  ttccttagagagctaaaaagctaaaaatcaaaa--
            PrzewalskisGazelle  ttccttagagagctagaaagctaaaaatcaaaac-
                         Oribi  ttccttagagagctaaaaagctaaaaatcaaaa-a
               ThomsonsGazelle  ttccctagagagctaaaaagctaaaaatcaaaa-a
                       Gerenuk  ttccttagagagctaaaaagctaaaaatcaaaa-a
                     Springbok  ttccttagagagctaaaaagctaaaaatcaaaa-a
                MaxwellsDuiker  ttccttagagagctaaaaagctgaaaatcaaaa-a
                 HarveysDuiker  ttctttagagagctaaaaagctgaaaatcaaaa-a
                 BohorReedbuck  ttccttagagagctaaaaagctaaaaatcaaaa-a
              DefassaWaterbuck  ttccttagagagctaaaaagctaaaaatcaaaa-a
                        Lechwe  ttccttagagagctaaaaagctaaaaatcaaaa-a
                       Gemsbok  ctccttagagagctaaaaagctaaaaatcaaaa-a
            ScimitarHornedOryx  ttccttagagagctaaaaagctaaaaatcaaaa-a
                  RoanAntelope  ttccttagagagctaaaaagctaaaaatcaaaa-a
                 SableAntelope  ttccttagagagctaaaaagctaaaaatcaaaa-a
                BlueWildebeest  ttccttagagagctgaaaagctaaaaataaaaa-a
                          Topi  ttccttagagagctaaaaagctaaaaatcaaaa-a
                        Herola  ttccttagagagctaaaaagctaaaaatcaaaa-a
               TibetanAntelope  ttccttagagggctaaaaagctaaaaatcaaaa-a
                  MountainGoat  ttccttagagagctaaaaagctaaaaatcagaa-a
               EuropeanMouflon  ttccttagagagctaaaaagctaaaaatcagaa-a
                AsiaticMouflon  ttccttagagagctaaaaagctaaaaatcagaa-a
                     SnowSheep  ttccttagagagctaaaaagctaaaaatcagaa-a
                  BighornSheep  ttccttagagagctaaaaagctaaaaatcagaa-a
                  BarbarySheep  ttccttagagagctaaaaagctaaaaatcagaa-a
                        Bharal  tttcttagagagctaaaaagctaaaaatcagaa-a
                   NilgiriTahr  ttccttagagagctaaaaagctaaaaatcagaa-a
B D                       ARS1  tttcttagagagctaaaaagctaaaaatcagaa-a
                      WildGoat  tttcttagagagctaaaaagctaaaaatcagaa-a
                  SiberianIbex  tttcttagagagctaaaaagctaaaaatcagaa-a
         ChineseForestMuskDeer  ttccttagagagctaaaaagctaaaaataaaaa-a
                  BlackMuntjac  ctccttagagagctcaaaagctaaaaataaaaa-a
                 IndianMuntjac  ctccttagagagctcaaaagctaaaaataaaaa-a
                 ReevesMuntjac  ctccttagagagctcaaaagctaaaaataaaaa-a
                PereDavidsDeer  ctccttagagagctcaaaagctaaaaataaaaa-a
               WhiteLippedDeer  ctccttagagagctcaaaagctaaaaataaaaa-a
                   YarkandDeer  ctccttagagagctcaaaagctaaaaataaaaa-a
                       RedDeer  ctccttagagagctcaaaagctaaaaataaaaa-a
                       HogDeer  ctccttagagagctcaaaagctaaaaattaaaa-a
               WhiteTailedDeer  ctccttagagagctaaaaagctaaaaataaaaa-a
                      MuleDeer  ctccttagagagctaaaaagctaaaaataaaaa-a
                      Reindeer  ctccttagagagctgaaaagctaaaaataaaaa-a
                EasternRoeDeer  ctccttagagagctaaagagctaaaaataaaaa-a
                   EurasianElk  ctccttagagagctaaaaagctaaaaataaaaa-a
              ChineseWaterDeer  ctccttagagagctaaagagctaaaaataaaaa-a
                       Giraffe  ttccttagagagctaaaaagctaaaaataaaaa-a
                     Pronghorn  ttccttagagaggtgaaaagc-aaggataaaac-a
                        Cattle  ttccttagagagctaaaaagctaaaaatcaaaa-a
                    ZebuCattle  ttccttagagagctaaaaagctaaaaatcaaaa-a
              SiberianMuskDeer  ttccttagagagctaaaaagctaaaaataaaaa-a
                         Okapi  ttccttagagagctaaaaagctaaaaataaaaa-a

Alignment block 13 of 177 in window, 129060349 - 129060459, 111 bps 
B D  Oar_rambouillet_v1_0_addY  tgaaatgcttgcatagcattcgtgttatatagtttaggatgacaact----ataacatgtttatgttttc
                 JavaMouseDeer  tgaaatgcttgcataacactcatggtatatcgtttagcatgacaact----ataacacgtttatgttttc
                         Bongo  tgaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
                         Saiga  tgaaatgcttgcacagcattcatgttatatagtttagtatgacaact----atagcatgttcatactttc
                         Gayal  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                    LesserKudu  taaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
                     Sitatunga  tgaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
                 MountainNyala  tgaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
               LesserMouseDeer  tgaaattcttgcataacactcatggtatatcgtttagcatgacaact----ataacacgtttatgttttc
                AlpineMuskDeer  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaacc----ataacattttaatattttc
                WesternRoeDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgatttc
                          Gaur  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                 AmericanBison  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                       WildYak  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                   DomesticYak  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                  WaterBuffalo  tgcaatgcgtgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                AfricanBuffalo  tgaaatgtttgcctagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                   CommonEland  taaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
                   GreaterKudu  taaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
                      Bushbuck  taaaatgcttgcctagcattcatgctatatagtttagtatgacaact----ataacatgtttatgttttc
                        Impala  tgaaatgcttgcatagcattcatgttatatagtttagcatgacaact----ataacatgtttatgttttc
                          Suni  tgaaatgcttgcatagcattcatgttatatagtttagaatgacaact----ataacatgtttatgttttc
                  Klipspringer  tgaaatgcttgcatggcattcatggtatatagattagtatgacaact----ataacatgtttatgttttc
                 RoyalAntelope  tgaaatgcttgcataacattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                   KirksDikDik  tgaaatgcttgcatagcattcacgttacatagtttagtatgacaact----atagcatgtttatgttttc
            PrzewalskisGazelle  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                         Oribi  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----atagcatgtttatgttttc
               ThomsonsGazelle  tgaaatgcttgcatagcattcatgttacatggtttagtatgacaact----atagcatgttcatattttc
                       Gerenuk  tgaaatgcttgcatagcatccatgttatatggtttagtatgacaact----atagcatgtttatgtttcc
                     Springbok  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----atagcatgtttatgttttc
                MaxwellsDuiker  tgaaatgcttgcatagcattcatgttatatagtttagtatggcaact----ataacatgtttatgttttc
                 HarveysDuiker  tgaaacgcttgcatagcgttcatgttatatagtttagtatggcaact----atagcatgtttatgttttc
                 BohorReedbuck  tgaaatgcttgcatagcattcgtgttatatagtttagtatgacaact----atagcatgtttatgttttc
              DefassaWaterbuck  tgaaatgcttgcatagcatttgtgtaatatagtttagtatgacaact----atagcatgtttatgttttc
                        Lechwe  tgaaatgcttgcatagcattcgtgttatatagtttagtatgacaact----atagcatgtttatgttttc
                       Gemsbok  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
            ScimitarHornedOryx  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                  RoanAntelope  tgaaatgcttacatagcattcatgttctatagtttagtatgacaact----ataacatgtttatgttttc
                 SableAntelope  tgaaatgcttacatagcattcatgttctatagtttagtatgacaact----ataacatgtttatgttttc
                BlueWildebeest  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                          Topi  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                        Herola  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
               TibetanAntelope  tgaaacgcttgcatagcagtcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                  MountainGoat  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
               EuropeanMouflon  tgaaatgcttgcatagcattcacgttatatagtttagtatgacaact----ataacatgtttatgttttc
                AsiaticMouflon  tgaaatgcttgcatagcattcgtgttatatagtttaggatgacaact----ataacatgtttatgttttc
                     SnowSheep  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                  BighornSheep  tgaaatgcttgcatagcattcrtgttatatagtttagtatgacaact----ataacatgtttatgttttc
                  BarbarySheep  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                        Bharal  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                   NilgiriTahr  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
B D                       ARS1  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                      WildGoat  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                  SiberianIbex  tgaaatgctcgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
         ChineseForestMuskDeer  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaaccataaataacattttaatattttc
                  BlackMuntjac  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
                 IndianMuntjac  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
                 ReevesMuntjac  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
                PereDavidsDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
               WhiteLippedDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
                   YarkandDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
                       RedDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgttttc
                       HogDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----atgacatgtttatgttttc
               WhiteTailedDeer  tgcaatgcttgcatagcattcatgttatatagttta----cacaact----atagcatgtttatgtgttc
                      MuleDeer  tgcaatgcttgcatagcattcatgttatatagttta----cacaact----ataacatgtttatgtgttc
                      Reindeer  tgcaatgcttgcatagcattcatgttatatagttta----cacaact----ataacatgtttatgtgttc
                EasternRoeDeer  tgaaatgcttgcatagcattcatgttatatagttta----cacagct----ataacatgtttatgatttc
                   EurasianElk  tgaaacgcttgcatagcattcatgttatatagttta----cacaact----ataacatgtttatgtgttc
              ChineseWaterDeer  tgaaatgcttgcatagcattcatgtcatatagttta----cacagct----ataacatgtttatgttttc
                       Giraffe  ttaaatgcttgcatagcattcatgttatatagtctagtatgacaact----ataacatgtttatgttttc
                     Pronghorn  cgaagtgcttgcagagccttcatgctatatagtttagcatgacaact----ctaacaggtttatgtttcc
                        Cattle  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
                    ZebuCattle  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc
              SiberianMuskDeer  tgaaatgcttgcataacattcatgttatatagtttagtatgacaacc----ataacattttaatattttc
                         Okapi  tgaaatgcttgcatagcattcatgttatatagtttagtatgacaact----ataacatgtttatgttttc

     Oar_rambouillet_v1_0_addY  acagcttaatgctaccaaggtgaaggattgggagacagtagcagc
                 JavaMouseDeer  acagtttaacagtaccaaggt-aagggctgggagatagtataagc
                         Bongo  acagcttaatgctatcaaggtaaaggattgggagacagtatcagc
                         Saiga  acagcttaatgctaccaaggtaaaggactgggagacagtatcagc
                         Gayal  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                    LesserKudu  acagcttaatgctaccaaggtaaaggattgggaaacagtatcagc
                     Sitatunga  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                 MountainNyala  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
               LesserMouseDeer  acagtttaacagtaccaaggt-aagggctgggagatagtataagc
                AlpineMuskDeer  acagcttaatgctaccaaggtaaagggttgggagacagtatcagc
                WesternRoeDeer  acagcttaatgctaccaaggtaaaggattgggagacagtaacagc
                          Gaur  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                 AmericanBison  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                       WildYak  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                   DomesticYak  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                  WaterBuffalo  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                AfricanBuffalo  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                   CommonEland  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                   GreaterKudu  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                      Bushbuck  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                        Impala  acagcttaatgctaccaaggtaaaggactgggagaca-tatcagc
                          Suni  acagcctaatgctaccaaggtaaaggattgggagacagtatcagc
                  Klipspringer  acagcttaatgctacccaggtaaaggattgggagatagtatcagc
                 RoyalAntelope  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
                   KirksDikDik  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
            PrzewalskisGazelle  acagcttaatgctaccaaggtaaagcattgggagacagtatcagc
                         Oribi  acagcttaatgctaccaaggtaaaggattaggagacagtatcagc
               ThomsonsGazelle  acagcttaatgctaccaaaataaaggactgggagacagtatcagc
                       Gerenuk  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                     Springbok  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                MaxwellsDuiker  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
                 HarveysDuiker  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
                 BohorReedbuck  acagcttaatgctaccaagggaaaggattgggagacagtatcagc
              DefassaWaterbuck  acagcttaatgctaccaagggaaaggattgggagacagtatcagc
                        Lechwe  acagcttaatgctaccaagggaaaggattgggagacagtatcagc
                       Gemsbok  acagcttaatgctaccagggtaaaggattgggagatagtatcagc
            ScimitarHornedOryx  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
                  RoanAntelope  acagcttaatgctaccgaggtaaaggattgggagatagtatcagc
                 SableAntelope  acagcttaatgctaccgaggtaaaggattgggagatagtatcagc
                BlueWildebeest  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
                          Topi  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
                        Herola  acagcttaatgctaccaaggtaaaggattgggagatagtatcagc
               TibetanAntelope  acagcttaatgctaccaaggtgaaggattgggagatagtatcagc
                  MountainGoat  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
               EuropeanMouflon  acagcttaatgctaccaaggtgaaggattgggagacagtagcagc
                AsiaticMouflon  acagcttaatgctaccaaggtgaaggattgggagacagtagcagc
                     SnowSheep  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                  BighornSheep  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                  BarbarySheep  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                        Bharal  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                   NilgiriTahr  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                          ARS1  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                      WildGoat  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
                  SiberianIbex  acagcttaatgctaccaaggtgaaggattgggagatagtagcagc
         ChineseForestMuskDeer  acagcttaatgctaccaaggtaaagggttgggagacagtatcagc
                  BlackMuntjac  acagcttaatgctaccaaggcgaaggattgggagacagtaacagc
                 IndianMuntjac  acagcttaatgctaccaaggcgaaggattgggagacagtaacagc
                 ReevesMuntjac  acagcttaatgctaccaaggcgaaggattgggagacagtaacagc
                PereDavidsDeer  ccagcttaatgctaccaaggtgaaggattgggagacagtaacagc
               WhiteLippedDeer  ccagcttaatgctaccaaggtgaaggattgggagacagtaacagc
                   YarkandDeer  ccagcttaatgctaccaaggtgaaggattgggagacagtaacagc
                       RedDeer  ccagcttaatgctaccaaggtgaaggattgggagacagtaacagc
                       HogDeer  ccagcttaatgctaccaaggtgaaggattgggagacagtaacagc
               WhiteTailedDeer  acagcttaatgctaccaaggtaaaggattgggagacagtaacagc
                      MuleDeer  tcagcttaatgctaccaaggtaaaggattgggagacagtaacagc
                      Reindeer  acagcttaatgctaccaaggtaaaggattgggagacagtaacagc
                EasternRoeDeer  acagcttaatgctaccaaggtaaaggattgggagacagtaacagc
                   EurasianElk  acagcttaatgctaccaaggtaaaggattgggagacagtaacagc
              ChineseWaterDeer  acagcttaatgctaccaaggtaaaggattgggagacagtaacagc
                       Giraffe  acagcttaatgctaccaaggtaaaggattgggagacagtataagc
                     Pronghorn  acagcttaatgctaccgagggaaaggattgggagacaggagcagc
                        Cattle  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
                    ZebuCattle  acagcttaatgctaccaaggtaaaggattgggagacagtatcagc
              SiberianMuskDeer  acagcttaatgctaccaaggtaaagggttgggagacagtatcagc
                         Okapi  acagcttaatgctaccaaggtaaaggattgggagacagtataggc

Alignment block 14 of 177 in window, 129060375 - 129060662, 288 bps 
B D  Oar_rambouillet_v1_0_addY  atatag--tttaggatgacaact----ataacatgtttatgttttcacagcttaatgctac----caagg
                        Rabbit  atctag--tttaat-tggcaaat----acagcatgcttatgccttcacagcctcataccaaccagcaagg
                         Horse  atttag--tttaatatgacaaat----ataacatgcttatgctttcacagcttaataccac----caagg
               ChinesePangolin  atttag--tttaa------------------------taagcattcacagcttaataccac----cagtg
                         Human  --ttaa--tttaataaggcaaatatagatagcatgcttatgctttcacaat--aataccac----caagg
                      Aardvark  agttac--tttaaaatggcaaat----acaacatgcttgtgctttcacagctgaatacca-----caggg
                     BlueWhale  -----g--tttaatatgacaact----ataacatgcttatgctttcacagcttaataccac----caagg
       CommonBottlenoseDolphin  atacag--tttaatgtgacaact----ataacatgcttatgctttcacagcttaata-cac----caagg
                   BelugaWhale  atacag--tttaatgtgacaact----ataacatgcttatgctttcacagcttaataccac----caagg
                           Pig  atatag--tttaataagacaaat----ataacatgcttatgctttcacagcttaatgccac----caagg
                FloridaManatee  atttaa--tttaaaatgacgaat----acaatatgcttatgctttcacagcttaaaaccac----caagg
           GreaterHorseshoeBat  atttaagttgtaatgtgacacat----acaacgtgcttatgctttcacagcttaataccac----taagg
       WesternEuropeanHedgehog  acttaa--tataataagacatat----aaaacatatctatgctccgacagcttaattccac----cacag
                    HouseMouse  atttaa--ttttatgcggaaaat----gtagaatgcttgtgtgttcagagtctcacacta-----taatg
              ChineseTreeShrew  atctag-----tataaggcaaat----ataacatgcttatgctttcacagctcaataccac----caaga
                        Alpaca  atatag--tttagcatgacaaat----aaaatatgcttatgttttcacagcttaataccac----caagg
             WildBactrianCamel  atatag--tttagcatgac---------caatatgcttatgttttcacagcttaataccac----caagg
                  ArabianCamel  atatag--tttagcatgac---------caatatgcttatgttttcacagcttaataccac----caagg
                    MinkeWhale  -----g--tttaatgtgacaact----ataacatgcttatgctttcacagcttaataccac----caagg
                   KillerWhale  atacag--tttaatgtgacaact----ataacatgcttatgctttcacagcttaata-cac----caagg
                    SpermWhale  atatag--tttaatgtgacaact----ataacatgcttatgctttcacagcttaataccac----caagg
                ChacoanPeccary  atatag--tttaataagacaaat----ataacatgcttaagctttcacagcttaataccac----caagg

     Oar_rambouillet_v1_0_addY  tgaaggattgggagacagtagcagccatgtg--aaaaa--------------ttt--------------a
                        Rabbit  c-gaggactggcagatactac-agcaatgtt--aaaaa--------------ctc--------------a
                         Horse  c-aaaaattgggagatagtacaagcaatgtt--aaaaa--------------ctt--------------a
               ChinesePangolin  t-aacaactgagagatactgcaagcaatgtt--aaaaa--------------ctt--------------a
                         Human  c-aaggactgggagatactacaagcagtgtt--taaaa--------------ctt--------------a
                      Aardvark  c-aatggaagggaggtactatgagcagtg-t--taaaa--------------tgg--------------a
                     BlueWhale  t-aaggattgggagatactacaagcaatgtg--aaaaacttgaaattttttaact--------------a
       CommonBottlenoseDolphin  t-aaggattgggagatactacaagcaacgtg--aaaaacttgaaattttttaact--------------a
                   BelugaWhale  t-aaggattgggagatactacaagcaatgtg--aaaaacttgaaattttttaact--------------a
                           Pig  c-aaggattgggagtttctacaagcaatgtg--gaaaa--------------------------------
                FloridaManatee  a-aaaggaagggagatactacaagcaatgtt--aaaac--------------ttt--------------a
           GreaterHorseshoeBat  c-aattattgagagagactacaaacaatgtt---aaaa--------------cgt--------------a
       WesternEuropeanHedgehog  t-agtgactgggagatactacaagcaatttttaaaaaa--------------act--------------a
                    HouseMouse  t-aaggactgtgagattctataggcagtgtt---aaag--------------cat---------------
              ChineseTreeShrew  c-aagggctggcaaatgcta---gcaatgtt--aaaaa--------------cat--------------c
                        Alpaca  c-aaggattgtaagatactgcaaacaatgtg--aaaaa--------------c----------------a
             WildBactrianCamel  c-aaggattgtaagatactgcaaacaatgtg--aaaaa--------------c----------------a
                  ArabianCamel  c-aaggattgtaagatactgcaaacaatgtg--aaaaa--------------c----------------a
                    MinkeWhale  t-aaggattgggagatactacaagcaatgtg--aaaaa--------------ctcgaaattttttaacta
                   KillerWhale  t-aaggattgggagatactacaagcaacgtg--aaaaa--------------cttgaaattttttaacta
                    SpermWhale  t-aaggattgggagatactacaagcaatgtg--aaaaa--------------cttgaaattttttaacta
                ChacoanPeccary  c-aagaattaggagttactacaagcaatgtg--gaaaa--------------aaggg-------------

     Oar_rambouillet_v1_0_addY  -catgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacag-gg-ttt-ttt----
                        Rabbit  -cagggaattttataagtgcactt-gtaaaccaaaatatgcatttattacaataa-gc-t-------tt-
                         Horse  -catgagatttcataattgcgtttggttgcctaaaataagcatttataataacaa-gt-ttt-----tt-
               ChinesePangolin  ccatgaaatttcataattgcatttggttgcctgaagtatggatttgc-ataacaaggt-ttt-----tt-
                         Human  -cattagattttagaattgtatttagttgtgtaaaataagtttt-----------------------tt-
                      Aardvark  -catgaaattttataattgcatttggttgtcagaaatatatatttataatatttt-gt-tttc---ctt-
                     BlueWhale  -catgaaatttcataactgcatttggttgtctgaaatatgcatttataataacag-gt-ttt-----tt-
       CommonBottlenoseDolphin  -catgaaatttcataactgcatttggttgtctgaaatatgcatttataataacag-gt-ttt-----tt-
                   BelugaWhale  -catgaaatttcataactgcatttggttgtctgaaatatgcatttataataacag-gt-ttt-----tt-
                           Pig  -----aaa------------ggttggttgtctgaaataggcatttgtaataacag-gt-ttt-----tt-
                FloridaManatee  -cgtgaaattttataattgcatttggttgtctgaaatatgtatttacta---------------------
           GreaterHorseshoeBat  -catgaaatttcctaattgcatttggtgggtggaaatatgcatttatagtaataa-gc-t--------tt
       WesternEuropeanHedgehog  -ggtaaagatt--------tatttggttgtctaaaatgtacatttgtaataatgc-at-t--------tt
                    HouseMouse  ---gagaaatttacaattacat----ttgtctaaaatgtgcactag-------------t--------tt
              ChineseTreeShrew  -cgtaaaattttataattgcatttggttgtctaaaacatgcatttataataaggg-tttt--------tt
                        Alpaca  -catgaaattc-ataattgcagttagttatctgaaatacgcatttataacagcag-ac-t--------tt
             WildBactrianCamel  -catgaaattt-gtaactgcagttagttatctgaaatatgcatttataacagcag-ac-t--------tt
                  ArabianCamel  -catgaaattt-gtaactgcagttagttatctgaaatatgcatttataacagcag-ac-t--------tt
                    MinkeWhale  -catgaaatttcataactgcatttggttgtctgaaatatgcatttataataacag-gt-t--------tt
                   KillerWhale  -catgaaatttcataactgcatttggttgtctgaaatatgcatttataataacag-gt-t--------tt
                    SpermWhale  -catgaaatttcataactgcatttggttgtctgaaatatgcatttataataacag-gt-t--------tt
                ChacoanPeccary  ----------------------ttggttgtctgaaatatgcatttgtaataatag-ct-t--------tt

     Oar_rambouillet_v1_0_addY  -tcactaataa---aag--agaaagg--aag----aaatctc-t-agatgttgaagcctatttgggcatt
                        Rabbit  -tcactagtaa---taa--agaaagg--aag----gaacttgct-agaattttaagcttctttgagca-c
                         Horse  -tcactaataa---tag--ag-aagg--aag----aaatttg-t-agacgtttaggtc-atttgagcatt
               ChinesePangolin  -tcactaataa---cag--agaaagg--aag----aaatttg-t-agatgtttaagcctatccgaacatt
                         Human  -tcactaataa---cagaaaaaaaaa--aag----aaacttgct-ggatgtttaagcttacttgagca-c
                      Aardvark  -ttacaaatga---tag--agaaagg--aag----acatttgtt-agctgtttaaacctttttgagca-t
                     BlueWhale  -c-----ataa---taa--agagaac--ag--aagaaatttg-t-agatgttgaagactatttgggaatt
       CommonBottlenoseDolphin  -c-----ataa---taa--agagaac--tggaaagaaatttg-t-agatgttgaagcctatgtgggcatt
                   BelugaWhale  -c-----ataa---taa--agagaac--cggaaagaaatttg-t-agatgttgaagcctatgtgggcatt
                           Pig  -tcactaatga---taa--agaaggg--aagatgtaaatttg-c-agatattgagccccattggggcatt
                FloridaManatee  -------ataa---tag--ggaaagg--aag-----catttg-ctagatgtttagacctatttgggca-t
           GreaterHorseshoeBat  ctcactcagaa---tag--agaaagg--aag----aaatttg-t-acatgtttgagcctatgtgagcatt
       WesternEuropeanHedgehog  tccact-------------agtgata--aag----agcttta-t-gaat-tccaagcctagttgagagtc
                    HouseMouse  ccccctgactc---aca--ctaaaga--gag----atctctgct-ggat------gtttatttgaaca-c
              ChineseTreeShrew  ttccccaaaaa---aag--agaaagg--aag----aaatttgct-acacattcaagcttatttaagca-c
                        Alpaca  ttgactaataa---cag--agaaagg--aag----aagtttg-t-agatgttgaaacctatttgggcatt
             WildBactrianCamel  ttgactaataa---cag--agaaagg--aag----aagtttg-t-agatgttgaaacctatttgggcatt
                  ArabianCamel  ttgactaataa---cag--agaaagg--aag----aagtttg-t-agatgttgaaacctatttgggcatt
                    MinkeWhale  ttca-taataa----ag--agaacag--aag----aaatttg-t-agatgttgaagactgtttgggcatt
                   KillerWhale  ttca-taataa----ag--agaactggaaag----aaatttg-t-agatgttgaagcctatgtgggcatt
                    SpermWhale  ttca-taataa----ag--agaacgg-aaag----aaatttg-t-aggtgttgaagcctatttgggcatt
                ChacoanPeccary  tttt-tactaataatag--agaaatg-aaga-tgtaaattta-c-aaatattgaaccctatttgggcatt

     Oar_rambouillet_v1_0_addY  tgctgaaca--cttagaatgacttctgttattcaaaactatttc-tcatagggtttttatgttcttcata
                        Rabbit  tgctgaaca--cctccagcgatttctgttattccaaac--tccc-tcacagtgt-tttgtgtgcttcaca
                         Horse  tgctgaac---accaaaatgacttctgttactcaaaactatttc-tcatagtgtttttatgttcttcaca
               ChinesePangolin  tgctggac---cctaggataacttctgttattcaaaac--tttc-tcatagtatttttaggttcttcaca
                         Human  tgctgaaaa--cctcaagtgatttctgttatttgaaactctctc----agtaatttttttgttcttcac-
                      Aardvark  tgctgaaca--cctagagttacttctgcttttgaaaactatctt-ttacaccatttttatgtttttcaca
                     BlueWhale  tgctgaaca--cctagaatgacttctgttattcaaaactatttc-tcccagtgtttttatgttcttcaca
       CommonBottlenoseDolphin  tgctgaaca--cctagaatgacttctgttattcaaaactatttc-tcacagtgtctttatgttcttcaca
                   BelugaWhale  tgctgaaca--cctagaatgacttctgttattcaaaactatttc-tcacagtgtttttatgttcttcaca
                           Pig  tgctgcacc--cctagaatgacttctgttattcagaacgatttc-tcacagtgtttctatgttcttcaca
                FloridaManatee  tgctgaatg--cctagagtta---ctgtcattcaaaactctctc-tcacagtgtttttatgtttttcaca
           GreaterHorseshoeBat  tgctgaatacctacacaatgacttctgttattcgaaacgatttc-tcacagtgtttttatgttctccaca
       WesternEuropeanHedgehog  ttctgaaca-----------gagtctgtttgtcaagactatttcttcactgtgattttatgttctttaca
                    HouseMouse  tgttccaca--gttagagtgctttctgttatttaaaactgtcag-tctcagagcttctatgctcttgaca
              ChineseTreeShrew  tgctgaaca--cctagagtgatttctgttatttaaaataatctc-tccaagtgcttgc-tgttctttcca
                        Alpaca  tgctgacaa--cctagaatgacttctgttattcaaaactatttc-tcacagtgtttttatgttcttcaca
             WildBactrianCamel  tgctgacaa--cctagaatgacttctgttattcaaaactatttc-tcacagtgtttttatgttcttcaca
                  ArabianCamel  tgctgacaa--cctagaatgacttctgttattcaaaactatttc-tcacagtgtttttatgttcttcaca
                    MinkeWhale  tgctgaaca--cctagaatgacttctgttattcaaaactatttc-tcacagtgcttttatgttcttcaca
                   KillerWhale  tgctgaaca--cctagaatgacttctgttattcaaaactatttc-tcacagtgtctttatgttcttcaca
                    SpermWhale  tgctgaaca--cctagaatgacttctgttattcaaaactatttc-tcacagtgtttttatgttcttcaca
                ChacoanPeccary  tgctgaacc--cctagaatgacttatgttattcagaactatttc-tcacagtgtttctacattcttcaca

     Oar_rambouillet_v1_0_addY  gag-----
                        Rabbit  gattaaaa
                         Horse  aattaaca
               ChinesePangolin  aattaaaa
                         Human  agttaaaa
                      Aardvark  aattaaaa
                     BlueWhale  aattaaag
       CommonBottlenoseDolphin  aattagag
                   BelugaWhale  aattagag
                           Pig  aattaaaa
                FloridaManatee  aatcaaaa
           GreaterHorseshoeBat  aat-----
       WesternEuropeanHedgehog  aat-----
                    HouseMouse  agc-----
              ChineseTreeShrew  aat-----
                        Alpaca  aat-----
             WildBactrianCamel  aat-----
                  ArabianCamel  aat-----
                    MinkeWhale  aat-----
                   KillerWhale  aat-----
                    SpermWhale  aat-----
                ChacoanPeccary  aat-----

Alignment block 15 of 177 in window, 129060460 - 129060466, 7 bps 
B D  Oar_rambouillet_v1_0_addY  catgtga
                 JavaMouseDeer  aatgtg-
                         Bongo  aatgtga
                         Saiga  catgtga
                         Gayal  aatgtga
                    LesserKudu  aatgtga
                     Sitatunga  aatgtga
               LesserMouseDeer  aatgtga
                AlpineMuskDeer  aatgtga
                WesternRoeDeer  aatgtga
                          Gaur  aatgtga
                 AmericanBison  aatgtga
                       WildYak  aatgtga
                   DomesticYak  aatgtga
                  WaterBuffalo  aatgtga
                AfricanBuffalo  aatgtga
                   CommonEland  aatgtga
                   GreaterKudu  aatgtga
                      Bushbuck  aatgtga
                        Impala  cctgtga
                          Suni  catgtga
                  Klipspringer  catgtga
                 RoyalAntelope  catgtga
                   KirksDikDik  catatga
            PrzewalskisGazelle  catgtga
                         Oribi  catgtga
               ThomsonsGazelle  catgtga
                       Gerenuk  catatga
                     Springbok  cctatga
                MaxwellsDuiker  catgtga
                 HarveysDuiker  catgtga
                 BohorReedbuck  catgtga
              DefassaWaterbuck  catgtga
                        Lechwe  catgtga
                       Gemsbok  catgtga
            ScimitarHornedOryx  catgtga
                  RoanAntelope  catgtga
                 SableAntelope  catgtga
                BlueWildebeest  catgtga
                          Topi  catgtga
                        Herola  catgtga
               TibetanAntelope  catgtga
                  MountainGoat  catgtga
               EuropeanMouflon  catgtga
                AsiaticMouflon  catgtga
                     SnowSheep  catgtga
                  BighornSheep  catgtga
                  BarbarySheep  catgtga
                        Bharal  catgtga
                   NilgiriTahr  catgtga
B D                       ARS1  catgtga
                      WildGoat  catgtga
                  SiberianIbex  catgtga
         ChineseForestMuskDeer  aatgtga
                  BlackMuntjac  agtgtga
                 IndianMuntjac  agtgtga
                 ReevesMuntjac  agtgtga
                PereDavidsDeer  aatgtga
               WhiteLippedDeer  aatgtga
                   YarkandDeer  aatgtga
                       RedDeer  aatgtga
                       HogDeer  aatgtgg
               WhiteTailedDeer  aatgtga
                      MuleDeer  aatgtga
                      Reindeer  aatgtga
                EasternRoeDeer  aatgtga
                   EurasianElk  aatgtga
              ChineseWaterDeer  agtgtga
                       Giraffe  aatgtga
                     Pronghorn  aatgtga
                        Cattle  aatgtga
                    ZebuCattle  aatgtga
              SiberianMuskDeer  aatgtga
                         Okapi  aatgtga

Alignment block 16 of 177 in window, 129060467 - 129060529, 63 bps 
B D  Oar_rambouillet_v1_0_addY  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                 JavaMouseDeer  aaactttacatgaaatttcctaatagcatttggttgtctgaaatatgcatttctaataacagg
                         Bongo  aaaatttacatgaaatttcctgattgcatttggttgcctgaaaggtgcatttataataacagg
                         Saiga  aaaatttacatgaaatttcctaattgcatttggttg-ctgaaatatgcatttataataacagg
                         Gayal  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                    LesserKudu  aaaatttacatgaaatttcctgattgcatttggttgcctgaaaggtgcatttataataacagg
                     Sitatunga  aaaatttacatgaaatttcctgattgcatttggttgcctgaaaggtgcatttataataacagg
               LesserMouseDeer  aac-tttacatgaaatttcctaatagcatttggttgtctgaaatatgcatttctaataacagg
                AlpineMuskDeer  aaaattcacatgaaagttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                WesternRoeDeer  aaagtttacatggaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                          Gaur  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                 AmericanBison  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                       WildYak  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                   DomesticYak  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                  WaterBuffalo  aaattttacatgaaagttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                AfricanBuffalo  aaattttacatgaaatttcctaattgcatttcgttgcctgaaatatgcatttataataacagg
                   CommonEland  aaaatttacatgaaatttcctgattgcatttggttgcctgaaaggtgcatttataataacagt
                   GreaterKudu  aaaattcacatgaaatttcctgattgcatttggttgcctgaaaggtgcatttataataacagg
                      Bushbuck  aaaatttacatgaaatttcctgattgcatttggttgcctgaaaggtgcatttataataacagg
                        Impala  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                          Suni  aaaatttgcatgaaatttcctaattgcatctggttgcctgaaatatgcatttataataacagg
                  Klipspringer  aaaacttacatgaaatttcctaattgcatttggttgcctgaaatatgcagttataataatagg
                 RoyalAntelope  aaattttacatgaaatttcctaattgtatttggttgcctgaaatatgcatttataataacggg
                   KirksDikDik  aaaatttacatgaaatttcctaattgcatttggttg-ctgaaatatgcatttataataacagg
            PrzewalskisGazelle  aaaatttacatgaaatttcctaattgcatttggttg-ctgaaatacgcatttataataacagg
                         Oribi  aaaatttacatgaaatttcctaattgcatttcgttg-ctgaaatatgcatttataataacagg
               ThomsonsGazelle  aaaatttacatgaaatttcctaattggatttggttg-ctgaaatgtgcatttataataacagg
                       Gerenuk  aaaatttacatgaaatttcctaattgcatttggttg-ctgaaatatgcatttataataactgg
                     Springbok  aaaatttacatgaaatttcctaattgcatttggttg-ctgaaatatgcatttataataacagg
                MaxwellsDuiker  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                 HarveysDuiker  aaaatttacatgaaatttcctaattgcatttggttgcctgaagtctgtatttataataacagg
                 BohorReedbuck  aaaatttacataaaatttcctaattgcatttggttgcctgaaatatgcatttataataacaga
              DefassaWaterbuck  aaaatttacataaaatttcctaattgcatttggttgcctgaaatatgcatttataataacaga
                        Lechwe  aaaatttacataaaatttcctaattgcatttggttgcctgaaatatgcatttataataacaga
                       Gemsbok  aaagttcacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
            ScimitarHornedOryx  aaagttcacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                  RoanAntelope  caagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                 SableAntelope  caagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                BlueWildebeest  aaaatttacatgaaattccctaattgcatgtggttgcctgaaatatgcatttataataacagg
                          Topi  aaaatttacatgaaattccctaattgcatgtggttgcctgaaatatgcatttataataacagg
                        Herola  aaaatttacatgaaattccctaattgcatgtggttgcctgaaatatgcatttataataacagg
               TibetanAntelope  aaaatttacgtgaaatttcctaattgcatttggttgcctgaaatatacatttataataacagg
                  MountainGoat  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
               EuropeanMouflon  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                AsiaticMouflon  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                     SnowSheep  aaaatttacatgaaatttcctaatcgcatttggttgcctgaaatatgcatttataataacagg
                  BighornSheep  aaaatttacatgaaatttcctaatcgcatttggttgcctgaaatatgcatttataataacagg
                  BarbarySheep  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                        Bharal  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                   NilgiriTahr  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
B D                       ARS1  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttcaaaaaacagg
                      WildGoat  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttcaaaaaacagg
                  SiberianIbex  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcattt---ataacagg
         ChineseForestMuskDeer  aaaattcacatgaaagttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                  BlackMuntjac  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                 IndianMuntjac  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                 ReevesMuntjac  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttgtaataacagg
                PereDavidsDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
               WhiteLippedDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                   YarkandDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                       RedDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                       HogDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
               WhiteTailedDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                      MuleDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                      Reindeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                EasternRoeDeer  aaagtttacatggaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                   EurasianElk  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
              ChineseWaterDeer  aaagtttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                       Giraffe  aaaatttacatgaaatttcctaattgcatttggttgcctgaaatatgcatttataataatagg
                     Pronghorn  aaaatttacatgaaatttcctaattgcatttgcttgccggaaatatgcatttaccataacagg
                        Cattle  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                    ZebuCattle  aaaatttacatcaaatttcctaattgcatttggttgcctgaaatatgcatttaaaataacagg
              SiberianMuskDeer  aaaattcacatgaaagttcctaattgcatttggttgcctgaaatatgcatttataataacagg
                         Okapi  aaaatttacatgaaatttcctaattgcatgtggttgcctgaaatatgcatttataataacagg

Alignment block 17 of 177 in window, 129060530 - 129060530, 1 bps 
B D  Oar_rambouillet_v1_0_addY  g-
                 JavaMouseDeer  -t
                         Bongo  -t
                         Saiga  -t
                         Gayal  -t
                    LesserKudu  -t
                     Sitatunga  -t
               LesserMouseDeer  -t
                AlpineMuskDeer  -t
                WesternRoeDeer  -t
                          Gaur  t-
                  WaterBuffalo  g-
                   CommonEland  t-
                   GreaterKudu  g-
                      Bushbuck  t-
                        Impala  t-
                          Suni  g-
                  Klipspringer  g-
                 RoyalAntelope  g-
                   KirksDikDik  g-
            PrzewalskisGazelle  g-
                 BohorReedbuck  g-
              DefassaWaterbuck  g-
                        Lechwe  g-
                       Gemsbok  g-
            ScimitarHornedOryx  g-
                  RoanAntelope  g-
                 SableAntelope  g-
                BlueWildebeest  g-
                          Topi  g-
                        Herola  g-
               TibetanAntelope  g-
                  MountainGoat  g-
               EuropeanMouflon  g-
                AsiaticMouflon  g-
                     SnowSheep  g-
                  BighornSheep  g-
                  BarbarySheep  g-
                        Bharal  g-
                   NilgiriTahr  g-
B D                       ARS1  g-
                      WildGoat  g-
                  SiberianIbex  g-
         ChineseForestMuskDeer  t-
                  BlackMuntjac  t-
                PereDavidsDeer  g-
               WhiteLippedDeer  g-
                   YarkandDeer  g-
                       RedDeer  g-
                       HogDeer  t-
               WhiteTailedDeer  g-
                      MuleDeer  g-
                      Reindeer  g-
                EasternRoeDeer  g-
                   EurasianElk  g-
                    ZebuCattle  g-
              SiberianMuskDeer  t-
                         Okapi  g-

Alignment block 18 of 177 in window, 129060531 - 129060537, 7 bps 
B D  Oar_rambouillet_v1_0_addY  t--t-ttt---tt
                 JavaMouseDeer  ---t-ttt---tt
                         Bongo  ---t-ttt---tt
                         Saiga  ---t-ttt---tt
                         Gayal  ---t-ttt---tt
                    LesserKudu  ---t-ttt---tt
                     Sitatunga  ---t-ttt---tt
               LesserMouseDeer  ---t-ttt---tt
                AlpineMuskDeer  ---t-ttt---tt
                WesternRoeDeer  ---t-ttt---tt
                          Gaur  t--t-ttt---tt
                 AmericanBison  t--t-ttt---tt
                       WildYak  t--t-ttt---tt
                   DomesticYak  t--t-ttt---tt
                  WaterBuffalo  t--t-ttt---tt
                AfricanBuffalo  t--t-ttt---tt
                   CommonEland  t--t-ttt---tt
                   GreaterKudu  t--t-ttt---tt
                      Bushbuck  g--t-ttt---tt
                        Impala  t--t-ttt---tt
                          Suni  t--t-ttt---tt
                  Klipspringer  g--t-ttt---tt
                 RoyalAntelope  t--t-ttt---tt
                   KirksDikDik  t--t-ttt---tt
            PrzewalskisGazelle  t--t-ttt---tt
                         Oribi  t--t-ttt---tt
               ThomsonsGazelle  t--t-ttt---tt
                       Gerenuk  t--t-ttt---tt
                     Springbok  t--t-ttt---tt
                MaxwellsDuiker  t--t-ttt---tt
                 HarveysDuiker  t--t-ttt---tt
                 BohorReedbuck  t--t-ttt---tc
              DefassaWaterbuck  t--t-ttt---tt
                        Lechwe  t--t-ttt---tt
                       Gemsbok  t--t-ttt---tt
            ScimitarHornedOryx  g--t-ttt---tt
                  RoanAntelope  t--t-ttt---tt
                 SableAntelope  t--t-ttt---tt
                BlueWildebeest  t--t-ttt---tt
                          Topi  t--t-ttt---tt
                        Herola  t--t-ttt---tt
               TibetanAntelope  t--t-ttt---tt
                  MountainGoat  t--t-ttt---tt
               EuropeanMouflon  t--t-ttt---tt
                AsiaticMouflon  t--t-ttt---tt
                     SnowSheep  t--t-ttt---tt
                  BighornSheep  t--t-ttt---tt
                  BarbarySheep  t--t-ttt---tt
                        Bharal  ---t-ttt---tt
                   NilgiriTahr  t--t-ttt---tt
B D                       ARS1  t--t-ttt---tt
                      WildGoat  t--t-ttt---tt
                  SiberianIbex  t--t-ttt---tt
         ChineseForestMuskDeer  t--t-ttt---tt
                  BlackMuntjac  t--t-ttt---tt
                 IndianMuntjac  ---t-ttt---tt
                 ReevesMuntjac  ---t-ttt---tt
                PereDavidsDeer  t--t-ttt---tt
               WhiteLippedDeer  t--t-ttt---tt
                   YarkandDeer  t--t-ttt---tt
                       RedDeer  t--t-ttt---tt
                       HogDeer  ttgt-ttt---tt
               WhiteTailedDeer  t--t-ttt---tt
                      MuleDeer  t--t-ttt---tt
                      Reindeer  t--t-ttt---tt
                EasternRoeDeer  a--t-ttt---tt
                   EurasianElk  t--t-ttt---tt
              ChineseWaterDeer  -------gatttt
                       Giraffe  -------g---tt
                     Pronghorn  -------g---tt
                        Cattle  t--t-ttt---tt
                    ZebuCattle  t--t-ttt---tt
              SiberianMuskDeer  t--tcttt---tt
                         Okapi  t--t-ttt---tt

Alignment block 19 of 177 in window, 129060538 - 129060538, 1 bps 
B D  Oar_rambouillet_v1_0_addY  c
                 JavaMouseDeer  c
                         Bongo  c
                         Saiga  c
                         Gayal  c
                    LesserKudu  c
                     Sitatunga  c
                 MountainNyala  c
               LesserMouseDeer  c
                AlpineMuskDeer  c
                WesternRoeDeer  c
                          Gaur  c
                 AmericanBison  c
                       WildYak  c
                   DomesticYak  c
                  WaterBuffalo  c
                AfricanBuffalo  c
                   CommonEland  c
                   GreaterKudu  c
                      Bushbuck  c
                        Impala  c
                          Suni  c
                  Klipspringer  c
                 RoyalAntelope  c
                   KirksDikDik  c
            PrzewalskisGazelle  c
                         Oribi  c
               ThomsonsGazelle  c
                       Gerenuk  c
                     Springbok  c
                MaxwellsDuiker  c
                 HarveysDuiker  c
                 BohorReedbuck  c
              DefassaWaterbuck  c
                        Lechwe  c
                       Gemsbok  c
            ScimitarHornedOryx  c
                  RoanAntelope  c
                 SableAntelope  c
                BlueWildebeest  c
                          Topi  c
                        Herola  c
               TibetanAntelope  c
                  MountainGoat  c
               EuropeanMouflon  c
                AsiaticMouflon  c
                     SnowSheep  c
                  BighornSheep  c
                  BarbarySheep  c
                        Bharal  c
                   NilgiriTahr  c
B D                       ARS1  c
                      WildGoat  c
                  SiberianIbex  c
         ChineseForestMuskDeer  c
                  BlackMuntjac  c
                 IndianMuntjac  c
                 ReevesMuntjac  c
                PereDavidsDeer  c
               WhiteLippedDeer  c
                   YarkandDeer  c
                       RedDeer  c
                       HogDeer  c
               WhiteTailedDeer  c
                      MuleDeer  c
                      Reindeer  c
                EasternRoeDeer  c
                   EurasianElk  c
              ChineseWaterDeer  c
                       Giraffe  c
                     Pronghorn  c
                        Cattle  c
                    ZebuCattle  c
              SiberianMuskDeer  c
                         Okapi  c

Alignment block 20 of 177 in window, 129060539 - 129060662, 124 bps 
B D  Oar_rambouillet_v1_0_addY  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
                 JavaMouseDeer  actaat-aaaatagagagaaagaaaattgtagatgttgaagcctatttgggcatttgctgaacatttaga
                         Bongo  actaat-aaaagagaaaagaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                         Saiga  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaatacttaga
                         Gayal  attaat-aaaagagaaaggaagaaatct-tagaggttgaagcctatttgggcatttgctgaacacttaga
                    LesserKudu  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcgtttgctgaacacttaga
                     Sitatunga  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                 MountainNyala  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcgtttgctgaacacttaga
               LesserMouseDeer  actaat-aaaatagagagaaagaaaattgtagatgttgaagcctatttgggcatttgctgaacatttaga
                AlpineMuskDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                WesternRoeDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                          Gaur  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatttgggcatttgctgaacacttaga
                 AmericanBison  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatttgggcatttgctgaacacttaga
                       WildYak  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatttgggcatttgctgaacacttaga
                   DomesticYak  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatttgggcatttgctgaacacttaga
                  WaterBuffalo  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatttgggcatttgctgaacacttaga
                AfricanBuffalo  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatttgggcatttgctgaacacttaga
                   CommonEland  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                   GreaterKudu  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggtgtttgctgaacacttaga
                      Bushbuck  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcgtttgctgaacacttaga
                        Impala  actaat-aagagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                          Suni  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                  Klipspringer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcttatttgggcatttgctgaacacttaga
                 RoyalAntelope  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                   KirksDikDik  agtaat-aaaagagagaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                      Steenbok  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
            PrzewalskisGazelle  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatt-----------tgaacacttaga
                         Oribi  actaat-aaaaaagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
               ThomsonsGazelle  actaa--aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                       Gerenuk  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                     Springbok  actaaa-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                MaxwellsDuiker  actaat-aaaagagaaaggaagaaatctgtggatgtggaagcctatttgggcatttgctgaacacttaga
                 HarveysDuiker  actaat-aaaagagaaaggaagaaatctgtggatgttgaagtctatttgggcatttgctgaacacttaga
                 BohorReedbuck  actaat-aaaagggaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
              DefassaWaterbuck  actaat-aaaagggaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                        Lechwe  actaat-aaaagggaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                       Gemsbok  gctaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctgaacacttaga
            ScimitarHornedOryx  gctaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctaaacacttaga
                  RoanAntelope  gctaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                 SableAntelope  gctaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                BlueWildebeest  actaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                          Topi  actaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                        Herola  actaat-aaaagagaaaggaagaagtctgtagatgttgaagcctatttgggcatttgctgaacacttaga
               TibetanAntelope  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                  MountainGoat  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
               EuropeanMouflon  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
                AsiaticMouflon  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
                     SnowSheep  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
                  BighornSheep  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
                  BarbarySheep  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                        Bharal  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
                   NilgiriTahr  actaat-aaaagagaaaggaagaaatctctagatgttgaagcctatttgggcatttgctgaacacttaga
B D                       ARS1  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                      WildGoat  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                  SiberianIbex  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
         ChineseForestMuskDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                  BlackMuntjac  actaat-taaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                 IndianMuntjac  actaat-taaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                 ReevesMuntjac  actaat-taaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                PereDavidsDeer  actaat----agagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
               WhiteLippedDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                   YarkandDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                       RedDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
                       HogDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
               WhiteTailedDeer  actaat-aaaagagaaaggaagaaatctgtagatggtgaagcctatttggacatttgctgaacacttaga
                      MuleDeer  actaat-aaaagagaaaggaagaaatctgtagatggtgaagcctatttggacatttgctgaacacttaga
                      Reindeer  actaat-aaaagagaaaggaagaaatctgtagatggtgaagcctatttggacatttgctgaacacttaga
                EasternRoeDeer  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacattcgctgaacacttaga
                   EurasianElk  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttggacatttgctgaacacttaga
              ChineseWaterDeer  actaat-aaaagagaaagggagaaatctgtagatgttaaagcctatttggacatttgctgaacacttaga
                       Giraffe  actaat-aaaagaaaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                     Pronghorn  actaataaaaaaagaaaggaagaaatctgtcaatgtggaagcctatttgggcatctgctgaacacttaga
                        Cattle  attaat-aaaagagaaaggaagaaatctgtagaggttgaagcctatctgggcatttgctgaacacttaga
                    ZebuCattle  attaat-aaaagagaaaggaagaaatctatagaggttgaagcctatttgggcgtttgctgaacacttaga
              SiberianMuskDeer  actaat-aaaagagaaaggaaaaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga
                         Okapi  actaat-aaaagagaaaggaagaaatctgtagatgttgaagcctatttgggcatttgctgaacacttaga

     Oar_rambouillet_v1_0_addY  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                 JavaMouseDeer  atgactgctgtcattcaaaactgtttctcataatgtttatatgttcttcacagag
                         Bongo  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                         Saiga  atgacttctgttattcaaaactatttctcataggatttttatgttcttcatagag
                         Gayal  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                    LesserKudu  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                     Sitatunga  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                 MountainNyala  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
               LesserMouseDeer  atgactgctgtcattcaaaactgtttctcataatgtttatatgttcttcacagag
                AlpineMuskDeer  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagac
                WesternRoeDeer  atgacttctgctattcaaaactatttctcacggggtttttatgttcttcacagag
                          Gaur  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                 AmericanBison  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                       WildYak  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                   DomesticYak  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                  WaterBuffalo  atgacttctgttattcaaaactatttctcatagagtttttatgttcttcacagag
                AfricanBuffalo  atgacttctgttattcaaaactatttctcatagagtttttatgttcttcaccgag
                   CommonEland  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcaaagag
                   GreaterKudu  atgacttctgttattcagaactatttctcatagggtttttatgttcttcacagag
                      Bushbuck  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                        Impala  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                          Suni  atgacc--------------ctatttctcatagggtttttatgttcttcacagag
                  Klipspringer  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                 RoyalAntelope  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                   KirksDikDik  atgacttctgttattcaaaactgtttttcatatgatttttatgttcttcatagag
                      Steenbok  atgacttctgttattcaaaactatttctcataggatttttatgttcttcatagag
            PrzewalskisGazelle  atgacttctgttattcaaaactatttctcataggatttttatgttcttcatagag
                         Oribi  atgacttctattattcaaaactatttctcataggatttttatgttcttcatagag
               ThomsonsGazelle  atgacttctgttattcaaaactatttctcataggatttttatgttcttcatagag
                       Gerenuk  acgacttctgttattcaaaactatttctcataggatttttatgttcttcatagag
                     Springbok  atgacttctgttattcaaaactatgtctcataggatttttatgttcttcatagag
                MaxwellsDuiker  atgacttctgttattcaaaactatttcttatagggtttttatgttcttcatagag
                 HarveysDuiker  atgacttctgttattcaaaactatttcttatagggtttttacgttcttcatagaa
                 BohorReedbuck  atgacttctgttattcaaaactatgtctcatagggtttttatgttcttcatagag
              DefassaWaterbuck  atgacttctgttattcaaaactatgtctcatagggtttttatgttcttcatagag
                        Lechwe  atgacttctgttattcaaaactatgtctcatagggtttttatgttcttcatagag
                       Gemsbok  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
            ScimitarHornedOryx  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                  RoanAntelope  atgacttctgttattcaaaactatttcttatagggtttttatgttcttcatagag
                 SableAntelope  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                BlueWildebeest  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagaa
                          Topi  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagaa
                        Herola  atgacttctgttattgaaaactatttctcatagggtttttatgttcttcatagaa
               TibetanAntelope  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                  MountainGoat  atgacttctgttatttaaaactatttctcatagggtttctatgttcttcatagag
               EuropeanMouflon  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                AsiaticMouflon  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                     SnowSheep  atgatttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                  BighornSheep  atgatttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                  BarbarySheep  ataacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                        Bharal  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                   NilgiriTahr  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                          ARS1  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                      WildGoat  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
                  SiberianIbex  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcatagag
         ChineseForestMuskDeer  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagac
                  BlackMuntjac  atgacttctgctattcaaaactatttctcaaagggtttttatgttcttcacagag
                 IndianMuntjac  atgacttctgctattcaaaactatttctcaaagggtttttatgttcttcacagag
                 ReevesMuntjac  atgacttctgctattcaaaactatttctcaaagggtttttatgttcttcacagag
                PereDavidsDeer  atgacttctgctattcaaaactatttctcatagggtttttatgttctttacagag
               WhiteLippedDeer  atgacttctgctattcaaaactatttctcatagggtttttatgttctttacagag
                   YarkandDeer  atgacttctgctattcaaaactatttctcatagggtttttatgatctttacagag
                       RedDeer  atgacttctgctattcaaaactatttctcataggatttttatgatctttacagag
                       HogDeer  atgacttctgctattcaaaactatttctcatagggtttttatgttctttacagag
               WhiteTailedDeer  atgacttctgctattcaaaactatttctcatggggtttttatgttcttcacagag
                      MuleDeer  atgacttctgctattcaaaactatttctcatggggtttttatrttcttcacagag
                      Reindeer  ttgacttctgctattcaaaactatttctcatggggtttttatgttcttcacagag
                EasternRoeDeer  atgacttctgctattcaaaactatttctcacggggtttttatgttcttcacagag
                   EurasianElk  atgacttctgctattcaaaactatttctcatggggtttttatgttcttcacagag
              ChineseWaterDeer  atgacttctgctattcaaaactatttctcatggggtttttatgttcttcacagag
                       Giraffe  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
                     Pronghorn  atgaattctgttattcaaaactgtttctcatagggtttttatgttcttcacagag
                        Cattle  atgacttctgttattcaaaactatttctcatagggtttttatggtcttcacagag
                    ZebuCattle  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagag
              SiberianMuskDeer  atgacttctgttattcaaaactatttctcatagggtttttatgttcttcacagac
                         Okapi  atgacttctgttattcaaaactgtttctcatagggtttttatgttcttcacagag

Alignment block 21 of 177 in window, 129060663 - 129060663, 1 bps 
B D  Oar_rambouillet_v1_0_addY  t
                 JavaMouseDeer  t
                         Saiga  t
                         Gayal  t
                    LesserKudu  a
                     Sitatunga  a
                 MountainNyala  a
               LesserMouseDeer  t
                AlpineMuskDeer  t
                WesternRoeDeer  t
                          Gaur  t
                 AmericanBison  t
                       WildYak  t
                   DomesticYak  t
                AfricanBuffalo  t
                   CommonEland  a
                   GreaterKudu  a
                      Bushbuck  a
                        Impala  t
                          Suni  t
                  Klipspringer  t
                 RoyalAntelope  t
                   KirksDikDik  t
                      Steenbok  t
            PrzewalskisGazelle  t
                         Oribi  t
               ThomsonsGazelle  t
                       Gerenuk  t
                     Springbok  t
                MaxwellsDuiker  t
                 HarveysDuiker  t
                 BohorReedbuck  t
              DefassaWaterbuck  t
                        Lechwe  t
                       Gemsbok  t
            ScimitarHornedOryx  t
                  RoanAntelope  t
                 SableAntelope  t
                BlueWildebeest  t
                          Topi  t
                        Herola  t
               TibetanAntelope  t
                  MountainGoat  t
               EuropeanMouflon  t
                AsiaticMouflon  t
                     SnowSheep  t
                  BighornSheep  t
                  BarbarySheep  t
                        Bharal  t
                   NilgiriTahr  t
B D                       ARS1  t
                      WildGoat  t
                  SiberianIbex  t
         ChineseForestMuskDeer  t
                  BlackMuntjac  t
                 IndianMuntjac  t
                 ReevesMuntjac  c
                PereDavidsDeer  t
               WhiteLippedDeer  t
                   YarkandDeer  t
                       RedDeer  t
                       HogDeer  t
               WhiteTailedDeer  t
                      MuleDeer  t
                      Reindeer  t
                EasternRoeDeer  t
                   EurasianElk  t
              ChineseWaterDeer  t
                       Giraffe  t
                     Pronghorn  t
                        Cattle  t
                    ZebuCattle  t
              SiberianMuskDeer  t
                         Okapi  t

Alignment block 22 of 177 in window, 129060663 - 129060815, 153 bps 
B D  Oar_rambouillet_v1_0_addY  tatctgattttgaaagctatt---acagtggaaaggataaaaaaatgttcttaat---aaacttaatgta
                        Rabbit  tgtttcctttcggaggctatt---acactgaggagca--agaaaata--ttttaa---atactttatgta
                         Horse  tattagattttgaaagttatt---cccctggagattaggaa-aaata-tttttta---aaatttaatgta
               ChinesePangolin  tatttaattttgaaagctatt---actctggaaagtctgaacaaata-ttttcaa---acatttagtgta
                      Aardvark  tattttgtttttaaagctact---gccctgaagagtatgaaaaaata-ttttcaa---aaattgaatgta
                     BlueWhale  tatctaattttgaaagctattacaacactggaaaatatgaaaaaatattttttat---aaatttaatgta
       CommonBottlenoseDolphin  tatctaattttgaaagctattacaacactggaaaatatgaaaaaatattttttat---aaatttaatgta
                   BelugaWhale  tatctaattttgaaagctattacaacactggaaaatatgaaaaaatattttttat---aaatttaatgta
                           Pig  tgtctaattttgaaagctatt---acactggaaagtat-aaaaaatatttttaaa---aaatttaatgtt
                FloridaManatee  tatcttattttgaaacctact---acattgaagagtgtgaaaaaata-tttaaaa---aaatttaatgta
           GreaterHorseshoeBat  tactcatttttgaaagctatt---acactggagagcatgaagaaatatttttaaa---aatcgtaatgta
       WesternEuropeanHedgehog  tatttaatcttgaaatct-tt---ac-------agtagggaaaaataattgttta---aa-cttaatgta
                    HouseMouse  ta-ttaattgtgaaagctact---gcactggaaagttaaagaagtta-------a---atattaaatgca
              ChineseTreeShrew  tatttaattttgaaagctatt---gcactaaagaatacaaaacaata-------------ttttaatgta
                        Alpaca  tatctaattttgaaagctatt---acactggaaagtataaaaa--tatttttaaa---aaatttaatgta
             WildBactrianCamel  tatctaattttgaaagctatt---acactggaaagtataaaaa--tatttttaaa---aaatttaatgta
                  ArabianCamel  tatctaattttgaaagctatt---acactggaaagtataaaaa--tatttttaaa---aaatttaatgta
                    MinkeWhale  tatctaattttgaaagctattacaacactggaaaatatgaaaaaatattttttat---aaatttagtgta
                   KillerWhale  tatctaattttgaaagctattacaacactggaaaatatgaaaaaatattttttat---aaatttaatgta
                    SpermWhale  tatctaattttgaaagctattacaacactggaaaatatgaaaa---atttttaaaaataaatttaatgta
                ChacoanPeccary  tatctaattttgaaatctact---atactggaaagtatgaaaaaatatttttaaa---aaatttaatgta
                         Human  -atttaattttgagagctatt---acactgaagaatatgcaaaaa-----ttaaa---tatcttaatgtg

     Oar_rambouillet_v1_0_addY  -ttagtaa---gagcaataaggaagtaaacacagcataatgataaatcatgagcca------atgagcag
                        Rabbit  -ttagtaa---gagcaatgacgaaataaac-----------------cgtgacttc------aaattcag
                         Horse  -ttagtaa---gaaaaatgatgaagtaaacatagcataatgat-aatcatgagcta------attatcat
               ChinesePangolin  -tcagtaa---gagcactaatgaagtaaacatagcataatgat-aatcatgagcaa------attatcaa
                      Aardvark  -ttaataatacaagcaatgttgaagtaagcat------atgat-aatcatgagctc------atgctcag
                     BlueWhale  -ttactaa---gagcaatgatgaagtaaacatagc---ataat-aatcatgagcta------attatcag
       CommonBottlenoseDolphin  -ttactaa---gagcaatgatgaagtaaacatagcataataat-aatcatgagcta------attatcag
                   BelugaWhale  -ttactaa---gagcaatgatgaagtaaacatagcataataat-aatcatgagcta------attataag
                           Pig  -ttggtaa---gagcaatgatgaagtaaacatagcataatggt-aattatgagcta------attatcag
                FloridaManatee  -ttagtaa---aagcaatgatgaagtaagcat------atgat-aatcgtgcacta------attatcag
           GreaterHorseshoeBat  -ttaataa---gagcaaagatgaagcaaacatagcataatgat-caccaggagctg------atgatcag
       WesternEuropeanHedgehog  -ttac-------agtcatgataaagtaaatatcacatcatgat-agctaccagtga------attgtctg
                    HouseMouse  -ttatcat---gagccacgatgaagcaggcatagcaaaataat-actcaggaccg-------agtatcag
              ChineseTreeShrew  ttttttaa---cagcactgatgaagtaa--atggcataatgat-aaccacaagctaaacatcaaaattag
                        Alpaca  -ttagtaa---gagcaatgatgaagtaaacatagcataacaga-aatcatgagcta------gtgattag
             WildBactrianCamel  -ttagtaa---gagcaatgatgaagtaaacatagcataataga-aatcatgagcta------atgattag
                  ArabianCamel  -ttagtaa---gagcaatgatgaagtaaacatagcataataga-aatcatgagcta------atgattag
                    MinkeWhale  -ttactaa---gagcaatgatgaagtaaacatagcatgataat-aatcatgagcta------attatcag
                   KillerWhale  -ttactaa---gagcaatgatgaagtaaacatagcataataat-aatcatgagcta------attatcag
                    SpermWhale  -ttactaa---gagcaatgatgaagtaaacatagcataataat-aatcatgagcta------attatcag
                ChacoanPeccary  -ttgttaa---gagaaatgatgaagtaaatatagcataatggt-aattatgagcta------attatcag
                         Human  -ttagtaa---gaacaataatgaagtaaacatagcataataat-catcatgaacta------aatattag

     Oar_rambouillet_v1_0_addY  aaaatg-c-taagaaataaacattttaattg----------------
                        Rabbit  aaaatg-tctaggaaataaacacttcagttgggcaagttacggctcc
                         Horse  aaaatg-cctaataaataaacattttaatcaaagaggttatagctca
               ChinesePangolin  aaaata-cctaagaaataaacattttaatcaagtaggttataactca
                      Aardvark  aaaatg-cctaaggaataaatattttactagagtaaattacggctca
                     BlueWhale  aaaatg-c-taagaaataaacattttaattgagtaggctatggctca
       CommonBottlenoseDolphin  aaaatg-c-taagaaataaacattttaattgagtaggctatggctca
                   BelugaWhale  aaaatg-c-taagaaataaacattttaattgagtaggctatggctca
                           Pig  aaaatg-c-caagaaataaacatttt-atcaagtaggttatggctca
                FloridaManatee  acaatg-cttaccatataaagattttactacaatatgttagggctca
           GreaterHorseshoeBat  aaaatgcc-taagaaatagacattttaatca----------------
       WesternEuropeanHedgehog  aaagtagc-taagaaataaacattttaacca----------------
                    HouseMouse  aaaacact-caggaaatgagca-ttaa--ct----------------
              ChineseTreeShrew  aaaatgcc-tatgaaataaaca-ttcaatcg----------------
                        Alpaca  aaaatg-c-caagaaataaacattttaatca----------------
             WildBactrianCamel  aaaatg-c-caagaaataaacattttaatca----------------
                  ArabianCamel  aaaatg-c-caagaaataaacattttaatca----------------
                    MinkeWhale  aaaatg-c-taagaaataaacattttaattg----------------
                   KillerWhale  aaaatg-c-taagaaataaacattttaattg----------------
                    SpermWhale  aaaatg-c-taagaaataaacattttaattg----------------
                ChacoanPeccary  aaaatg-c-caagaaataaacatttt-atca----------------
                         Human  aaaatg-cctaagaaataaacattttaattgggtaggttatggctca

Alignment block 23 of 177 in window, 129060664 - 129060859, 196 bps 
B D  Oar_rambouillet_v1_0_addY  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                 JavaMouseDeer  atctaatttt-tgcaagctattactgtggaaaatat---aaaaaa--tatatttt----tatgaacttaa
                         Bongo  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                         Saiga  atctaa-ttt-tgaaagctattacagtggaaatgac-aaaaaaaa--tat-tctt----aataaac--aa
                         Gayal  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                    LesserKudu  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                     Sitatunga  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttta
                 MountainNyala  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
               LesserMouseDeer  atctaa-ttt-tgcaagctattactgtggaaaatat---aaaaaa--tatatttt----tatgaacttaa
                AlpineMuskDeer  atctaa-ttt-tgaaagctattatagtggaaaggat----aaaaa--tat-tctt----aataaactcag
                WesternRoeDeer  atctaa-ttt-tgaaagctattacagtggaaaggat---aaaaaa--tat-tctt----aataaa--caa
                          Gaur  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                 AmericanBison  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                       WildYak  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                   DomesticYak  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                  WaterBuffalo  ---taa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaac--aa
                AfricanBuffalo  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaactaaa
                   CommonEland  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                   GreaterKudu  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                      Bushbuck  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                        Impala  atctaa-ttt-tgaaagctattccagtggaaaggat--aaaaaaa--tgt-tctt----gataaacttaa
                          Suni  atctaa-ttt-tgaaagctattacagtggaaaggataaaaaaaaa--tgt-tctt----aataaacttaa
                  Klipspringer  atctaa-ttt-tgaaagttatttcagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                 RoyalAntelope  atctag-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aatagacttaa
                   KirksDikDik  atctaa-ttt-tgaaagctattacagtggaaaggat---aaaaaa--tat-tatt----aataaa-ttaa
                      Steenbok  atctaa-ttt-tgaaagctattacagtggaaaggat---aaaaaa--tat-tctt----aataaacttaa
            PrzewalskisGazelle  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tat-cctt----aataaacttaa
                         Oribi  atctaa-ttt-tgaaagctattacagtggaaaggat---aaaaaa--tat-tctt----aataaacttaa
               ThomsonsGazelle  atctaa-ttt-tgaaagctattacagtggaaatgat--aaaaaaa--tat-tctt----aataaacttaa
                       Gerenuk  atctaa-ttt-tgaaagctattacagtggaaatgat--aaaaaaa--tat-tctt----aataaacttaa
                     Springbok  atctaa-ttt-tgaaagctattacagtggaaatgat--aaaaaaa--tat-tctt----aataaacttaa
                MaxwellsDuiker  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                 HarveysDuiker  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                 BohorReedbuck  atctaa-tttatgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
              DefassaWaterbuck  atctaa-tttatgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                        Lechwe  atctaa-tttatgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                       Gemsbok  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
            ScimitarHornedOryx  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                  RoanAntelope  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                 SableAntelope  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                BlueWildebeest  atctaa-ttt-tgaaagctattacagtgaaaaggat--aaaaaaa---gt-tctt----aataaacttaa
                          Topi  atctaa-ttt-tgaaagctattacagtgaaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                        Herola  atctaa-ttt-tgaaagctattacagtgaaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
               TibetanAntelope  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                  MountainGoat  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
               EuropeanMouflon  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                AsiaticMouflon  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                     SnowSheep  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                  BighornSheep  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                  BarbarySheep  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                        Bharal  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                   NilgiriTahr  atctga-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
B D                       ARS1  a----a-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                      WildGoat  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
                  SiberianIbex  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tgt-tctt----aataaacttaa
         ChineseForestMuskDeer  atctaa-ttt-tgaaagctattatagtggaaaggat----aaaaa--tat-tctt----aataaactcaa
                  BlackMuntjac  atctaa-ttt-tgaaagctattacagtggaaaggat---aaaaaa--tat-tctt----aataaacttaa
                 IndianMuntjac  atctaa-ttt-tgaaagttattacagtggaaaggat--aaaa-aa--tat-tcttaataaataaacttaa
                 ReevesMuntjac  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaa-aa--tat-tcttaataaataaacttaa
                PereDavidsDeer  atctaa-ttt-tgaaagctattgcagtggaaaggat--aaga-aa--tat-tctt----aataaacttaa
               WhiteLippedDeer  atctaa-ttt-tgaaagctattacagtggaaaggat--aaga-aa--tat-tctt----aataaacttaa
                   YarkandDeer  atctaa-ttt-tgaaagctattacagtggaaaggat--aaga-aa--tat-tctt----aataaacttaa
                       RedDeer  atctaa-ttt-tgaaagctattacagtggaaaggat--aaga-aa--tat-tctt----aataaacttaa
                       HogDeer  atctaa-ttt-tgaaagctattatagtggaaaggat--aaga-aa--tat-tctt----aataaacttaa
               WhiteTailedDeer  atctaa-ttt-tgaaagccattacagtgaaaaggat--aaaa-aa--tat-tctt----aataaac--aa
                      MuleDeer  atctaa-ttt-tgaaagccattacagtgaaaaggat--aaaa-aa--tat-tctt----aataaac--aa
                      Reindeer  atctaa-ttt-tgaaagccattacagtgaaaaggat--aaaa-aa--tat-tctt----aataaac--aa
                EasternRoeDeer  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaa-aa--tat-tctt----aataaac--aa
                   EurasianElk  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaa-aa--tat-tctt----aat-aac--aa
              ChineseWaterDeer  atctaa-ttt-tgaaagctattacggtggaaaggat--aaaa-aa--tgt-tctt----aatatac--aa
                       Giraffe  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaa-aaataat-tctt----aatgaacttaa
                     Pronghorn  atctaa-ttt-tgaaagctattgcagtggaaaggat--aaaa-aa--tat-tctg----aataaacttca
                        Cattle  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
                    ZebuCattle  atctaa-ttt-tgaaagctattagagtggaaaggat--aaaagaa--tat-tctt----aataaacttaa
              SiberianMuskDeer  atctaa-ttt-tgaaagctattatagtggaaaggat----aaaaa--tat-tctt----aataaactcaa
                         Okapi  atctaa-ttt-tgaaagctattacagtggaaaggat--aaaaaaa--tat-tctt----aatgaacttaa

     Oar_rambouillet_v1_0_addY  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                 JavaMouseDeer  tgtattagtaagggcaatgaggatttaaacacagcataatgat-aatcatgagctaattatcagaaaatg
                         Bongo  tgtattagtaagagcaataaggaggtaaacacagcataatgaaaaattgtgagctaatcagcagaaaatg
                         Saiga  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaa-------------
                         Gayal  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatt
                    LesserKudu  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatg
                     Sitatunga  tgtattagtaagagcaataaggaggtaaacacagcataatgaaaaatcgtgagctaatcagcagaaaatg
                 MountainNyala  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcgtgagctaatcagcagaaaatg
               LesserMouseDeer  tgtattagtaagggcaatgaggatttaaacacagcataatgat-aatcatgagctaattatcagaaaatg
                AlpineMuskDeer  tgtatt----agagcaataaggaaataaaca--gcataatgataaatcatgagctaattagcagaaaatg
                WesternRoeDeer  tgtatt----agagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                          Gaur  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatt
                 AmericanBison  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatt
                       WildYak  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatt
                   DomesticYak  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatt
                  WaterBuffalo  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatg
                AfricanBuffalo  cgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatg
                   CommonEland  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatg
                   GreaterKudu  tgtattagtaagagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagagaatg
                      Bushbuck  tgtatt----agagcaataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatg
                        Impala  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                          Suni  tgtattagtaacagcaataaggaagtaaacatagcataatgataaatcatgcgccaaggagcagaaaatg
                  Klipspringer  tgtattagtaagagcaacaaagaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                 RoyalAntelope  tatattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                   KirksDikDik  tgtatt----agagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                      Steenbok  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgtgcagaaaatg
            PrzewalskisGazelle  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                         Oribi  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
               ThomsonsGazelle  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaa-------------
                       Gerenuk  tgtattagtaagagcaataagggagtaaacacagcataatgataaatcatgagccaa-------------
                     Springbok  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                MaxwellsDuiker  tgtattagtaagagcaataaggaagtaa--actgcataatgataaatcatgagccaatgagcagaaaatg
                 HarveysDuiker  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                 BohorReedbuck  tgtattagtaagagcaataaagaagtaaacacagcatgatgataaatcatgaaacaatgagcagaaaatg
              DefassaWaterbuck  tgtattagtaagagcaataaagaagtaaacacagcatgatgataaatcatgagccaatgagcagaaaatg
                        Lechwe  tgtattagtaagagcaataaagaagtaaacacagcatgatgataaatcatgagccaatgagcagaaaatg
                       Gemsbok  tgtagtagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
            ScimitarHornedOryx  tgtagtagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                  RoanAntelope  tgtagtagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                 SableAntelope  tgtagtagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                BlueWildebeest  tgtattagtaagagcaataagaaagtaaacatagcataatgataaatcatgagcccatgagcagaaaatg
                          Topi  tgtattagtaagagcaataagaaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                        Herola  tgtattagtaagagcaataagaaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
               TibetanAntelope  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                  MountainGoat  tgtattagtaagagcaataaggaagtaaacacagcatgatgataaatcatgagccaatgagcagaaaatg
               EuropeanMouflon  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                AsiaticMouflon  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                     SnowSheep  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                  BighornSheep  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                  BarbarySheep  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                        Bharal  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                   NilgiriTahr  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                          ARS1  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                      WildGoat  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
                  SiberianIbex  tgtattagtaagagcaataaggaagtaaacacagcataatgataaatcatgagccaatgagcagaaaatg
         ChineseForestMuskDeer  tgtatt----agagcaataaggaaataaaca--gcataatgataaatcatgagctaattagcagaaaatg
                  BlackMuntjac  tgtattagtaagagcaataaggaagtaaacattgcataatgataaatcatgagctaattagcagaaaatg
                 IndianMuntjac  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                 ReevesMuntjac  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                PereDavidsDeer  tgtatt----agagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
               WhiteLippedDeer  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                   YarkandDeer  tgtattagtaagagcaataaggaagtaaatactgcataatgataaatcatgagctaattagcagaaaatg
                       RedDeer  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                       HogDeer  tgtactagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
               WhiteTailedDeer  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                      MuleDeer  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                      Reindeer  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                EasternRoeDeer  tgtatt----agagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                   EurasianElk  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
              ChineseWaterDeer  tgtattagtaagagcaataaggaagtaaacactgcataatgataaatcatgagctaattagcagaaaatg
                       Giraffe  tgtattagttagagcaataaggaagtaaacacagcataatgataaatcatgagctaattagcagaaaatg
                     Pronghorn  ggtattagtaagagcaa-aaggaaataaacacagcataatgataaatcataagctaattagcagaaaatg
                        Cattle  tgtattagtaagagcaataaggaagtaaacacagcatagtgaaaaatcatgagctaatcagcagaaaatt
                    ZebuCattle  tgtattagtaagagctataaggaagtaaacacagcataatgaaaaatcatgagctaatcagcagaaaatt
              SiberianMuskDeer  tgtatt----agagcaataaggaaataa--acagcataatgataaatcatgagctaattagcagaaaatg
                         Okapi  tgtattagtaagagcaataaggaagtaaacacagcataatgataaaccatgagctaattagcagaaaatg

     Oar_rambouillet_v1_0_addY  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                 JavaMouseDeer  ctaagaaataaacattttaattgagtaggttatgactcacaagttcccacttaaaccttgaccatgg
                         Bongo  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccacttataccctgaccatgg
                         Saiga  -taagaaataaacattttaattgagtaggttatggcttgcaaagttccacttgtaccctgaccatgg
                         Gayal  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                    LesserKudu  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccacttataccctgaccatgg
                     Sitatunga  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccacttataccctgaccatgg
                 MountainNyala  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccacttataccctgaccatgg
               LesserMouseDeer  ctaagaaataaacattttaattgagtaggttatgactcacaagttcccacttaaaccttgaccatgg
                AlpineMuskDeer  ctaagaaataagcattttaattgagtaggttatggcttacaaagttccacttataccctggccatgg
                WesternRoeDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaacttccacttataccctgaccatgg
                          Gaur  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                 AmericanBison  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                       WildYak  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                   DomesticYak  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                  WaterBuffalo  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                AfricanBuffalo  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                   CommonEland  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccacttataccctgaccatgg
                   GreaterKudu  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccacttataccctgaccatgg
                      Bushbuck  ctaagaaataaacattttaattgagtaggttatagcttacaaagttccagttataccctgaccatgg
                        Impala  ctaagaaataaacatttcaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                          Suni  ctaagaaataaacattttaattgtgtaggttatggcttacaaagtttcacttataccctgaccatgg
                  Klipspringer  ctaagaaataaacattttaattgagtaggtta------aaaaagttccgcttataccctgaccatgg
                 RoyalAntelope  ctaagaaataaacattttaattgaggaggttatggcttacaaagttccacttataccctgaccatgg
                   KirksDikDik  ctaagaaataaacattttaattgagtaagttatgacttacaaagttccacttataccctgaccatgg
                      Steenbok  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
            PrzewalskisGazelle  ctaagaaataaacattttaactgagtaggttatggcttgcaaagttccacttgtaccctgaccatgg
                         Oribi  ctaagaaataaacattttgattgagtaggttatggcttgcaaagttccacttgtaccctgaccatgg
               ThomsonsGazelle  -taagaaataaacattttaattgagtaggttatggcttgcaaagttccacttgtaccctgaccatgg
                       Gerenuk  -taagaaattaatattttaattgagtaggttatggcttgcaaagttccacttgtaccctgaccatgg
                     Springbok  ctaagaaataaacattttaactgagtaggttatggcttgcaaagttccacttgtaccctgaccatgg
                MaxwellsDuiker  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                 HarveysDuiker  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                 BohorReedbuck  ctaagaaataaacatcttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
              DefassaWaterbuck  ctaagaaataaacatcttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                        Lechwe  ctaagaaataaacatcttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                       Gemsbok  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
            ScimitarHornedOryx  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                  RoanAntelope  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                 SableAntelope  ctaagaaataaacattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                BlueWildebeest  ttaagaaataaacattttaattgagtagattatggcttacaaagttccacttataccctgaccatgg
                          Topi  ttaagaaataaacattttaattgagtagattatggcttacaaagttccacttataccctgaccatgg
                        Herola  ttaagaaataaacattttaattgagtagattatggcttacaaagttccacttataccctgaccatgg
               TibetanAntelope  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                  MountainGoat  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcctacttataccctgaccatgg
               EuropeanMouflon  ctaagaaataaacgttttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                AsiaticMouflon  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                     SnowSheep  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                  BighornSheep  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                  BarbarySheep  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                        Bharal  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                   NilgiriTahr  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                          ARS1  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                      WildGoat  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
                  SiberianIbex  ctaagaaataaacattttaattgagtaggttatggcttacaaagtcccacttataccctgaccatgg
         ChineseForestMuskDeer  ctaagaaataagcattttaattgagtaggttatggcttacaaagttccacttataccctggccatgg
                  BlackMuntjac  ctaagaaataaacactttaattgagtagcttatggcttacaaagttccccttataccctgaccatgg
                 IndianMuntjac  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccccttataccctgaccatgg
                 ReevesMuntjac  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccccttataccctgaccatgg
                PereDavidsDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
               WhiteLippedDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                   YarkandDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                       RedDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
                       HogDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
               WhiteTailedDeer  ctaagaaataaacactttaattgaataggttatggcttacaaagttccacttataccctgaccatgg
                      MuleDeer  ctaagaaataaacactttaattgaataggttatggcttacaaagttycacttataccctgaccatgg
                      Reindeer  ctaagaaataaacactttaattgagtaggttatggcttacgaagttccacttataccctgaccatgg
                EasternRoeDeer  ctaagaaataaacactttaattgagtaggttatggcttacaaacttccacttataccctgaccatgg
                   EurasianElk  ctacgaaataaacactttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg
              ChineseWaterDeer  ctaagaaataaacactttaattgagtaggttatgtcttacaaacttccacttataccctgaccatgg
                       Giraffe  ctaagaaataagcattttaattgagtaggttatggcttacaaagttccacttacaccctgaccatgg
                     Pronghorn  ctaataaataaacatgttaattgagtaggttatggtttacaaagttccacttataccctgaccatgg
                        Cattle  ctaagaaataaacattttaa----------------ttacaaagttccacttataccctgaccatgg
                    ZebuCattle  ctaagaaataaacattttaattgagtagattatggcttacaaagttccacttataccctgaccatgg
              SiberianMuskDeer  ctaagaaataagcattttaattgagtaggttatggcttacaaagttccacttataccctggccatgg
                         Okapi  ctaagaaataagcattttaattgagtaggttatggcttacaaagttccacttataccctgaccatgg

Alignment block 24 of 177 in window, 129060832 - 129061402, 571 bps 
B D  Oar_rambouillet_v1_0_addY  caaagtcccacttataccctgaccatggt--actattgtt--gaga----gtacctggtctgcaca-tat
                        Rabbit  tgaagtcct-ctcgtaccttgaccatggt--gctattgtt--ggca----gtactgagtgtgtgta-ttt
                         Horse  gag--tcctgcttacaccttgaccatagt--actattgtt--gaga----gcacccggggtgcaca-ttt
               ChinesePangolin  caa---------agtaccttaaccatggc--actattgtt--gaga----gtacccagtctgcatg-ttt
                         Human  caaagtcctccttgtaccttgaccatagt--actattatt--gaga----gtacccagtttgtgta-ctt
                      Aardvark  cgaagcctcacttataccttgaccatggt--gctgttgtt--aata----gtacccagtcttcaaa-ttt
                     BlueWhale  caaagtcccacttataccttgaccatggt--actattgtt--aaga----gtacccgacctgcata-ttt
       CommonBottlenoseDolphin  caaagtcccacttataccttgaccatggt--actattgtt--gaaa----gtacccgatctgcata-ttt
                   BelugaWhale  caaagtcccacttataccttgaccgtggt--actattgtt--gaaa----gtacccgatctgcata-ttt
                           Pig  caaagtcctgcttataccttgaccatggt--actattgtt--gaga----gtaccctgtctgaata-ttt
                FloridaManatee  caaagtcttacttgtaccttgaccatggt--actattatt--gaaa----gtactccttctgcaaa-ttt
           GreaterHorseshoeBat  caaagtgtcacttaagccttgaccatggt--actgttgtt--gtgg----gtccccagtctgcata-ttt
       WesternEuropeanHedgehog  caaagtccgactaatctattgactatggttagttactact--ataggaaagtacacagtctgcata-taa
                    HouseMouse  tgaaatgct-cctgtgccccttca----t--agcaccgcactgaga----gcgtcctggctgtgag-cgt
              ChineseTreeShrew  tgaagtcctatctgtactctgacaagggt--attattgtg--gaga----gtacctagtctgtctg-ttt
                        Alpaca  caaagccctacttataccttggccatggt--gctattgtt--gaga----atacccggtctgcacatttt
             WildBactrianCamel  caaagtcctacttataccttggccatggt--gctattgtt--gaga----atacccggtctgcaca-ttt
                  ArabianCamel  caaagtcctacttataccttggccatggt--gctattgtt--gaga----atacccggtctgcaga-ttt
                    MinkeWhale  caaagtcccacttataccttgaccatggt--actattgtt--aaga----gtacccgatctgcata-ttt
                   KillerWhale  caaagtcccacttataccttgaccatggt--actattgtt--gaaa----gtacccgatctgcata-ttt
                    SpermWhale  caaagtcccacttataccttgaccatggt--actattgtt--gaga----gtacccgatctgcata-ttt
                ChacoanPeccary  caaagtcctgcttataccttgaccatggt--actattgtt--gaga----ctaccctgtctgcata-ttt

     Oar_rambouillet_v1_0_addY  ctagg-aggcaca-t-gcttaataaccttctaaaatattatt----------------tgattcctcata
                        Rabbit  ccaagcaggcata-ctgcttaataaccttcgcgaa---tatt----------------tcattcttcata
                         Horse  ccaggcaggcaca-ttgcttaataatctcctaaaatacaatt----------------ttattcttcttg
               ChinesePangolin  ccaggcaggcaca-ttgcttaataaccttctaaaatattatttcagtcttgatgggacttagtcttcatg
                         Human  ccaagcaggcaca-gtgcttaataaccttctaaaa---tatt----------------ttattcttcctg
                      Aardvark  tcagggaggcaca-ctgcttaataaccttctaaaatattatt----------------tcattttttatg
                     BlueWhale  ccaggcaggcaca-t-gcttaataacctcctaaagtattatt----------------ttactcttcata
       CommonBottlenoseDolphin  ccaggcaggcaca-t-gcttaataacttcctaaagtattatt----------------ttactcttcata
                   BelugaWhale  ccaggcaggcaca-t-gcttaataacctcctaaagtattatt----------------ttactcttcata
                           Pig  ccaggcaggcaca-t-gcttaataagct-ctacaatattatt----------------ttctttttcata
                FloridaManatee  ccagggaggtacc-cagcttaataaccttctaaaatattatt----------------ttattctttatg
           GreaterHorseshoeBat  ccaggcaggaacatc-gcttactaagcttctgaaatattatt----------------ttattcttcatg
       WesternEuropeanHedgehog  gccagcagtcacact-gcctaatag---ccagaaagatcatt----------------ttattcttcatg
                    HouseMouse  ccaggcaggaacagt-gatcggtaa---ccctctaaaagatt----------------taattctttatg
              ChineseTreeShrew  ccaagcaggcacatt-acttaataa---ccttgcaaaatatg----------------ttattcttaatg
                        Alpaca  ccaggcaggcacact-gcttaatatccttctaaaatatgatt----------------ttattattcatg
             WildBactrianCamel  ccaggcaggcacact-gcttaataaccttctaaaatatgatt----------------ttattattcatg
                  ArabianCamel  ccaggcaggcacact-gcttaataaccttctaaaatatgatt----------------ttattattcatg
                    MinkeWhale  ccaggcaggcaca-t-gcttaataacctcctgaagtattatt----------------ttactcttcata
                   KillerWhale  ccaggcaggcaca-t-gcttaataacctcctaaagtattatt----------------ttactcttcata
                    SpermWhale  ccaggcaggcaca-t-gcttaataacctcctaaagtattatt----------------ttactcttcata
                ChacoanPeccary  ccaggcaggcaca-t-gcttaataagct-ctaaaatattatt----------------ttctttttcata

     Oar_rambouillet_v1_0_addY  ggagg------g----agaacta-ttacctgtatgtagtatctatattgtttctgaaagataatatgttt
                        Rabbit  at-gg------a----acgacta-ttacctgt----agtatcaacgttgctcctggaagaaaatgtattt
                         Horse  ggagg------g----aggacta-ctacctgt----agtatctatattgcttctgaaagataatatattt
               ChinesePangolin  ggagg------a----aggaata-ttacctgt----aatatctatattgcttttgaaaaataatgtactt
                         Human  agagg------g----agggctt-ttacctgt----agtatctacactgcttctgacagataacatattt
                      Aardvark  ggagg------g----acaatttattacctgt----agtatctccattgtttctgacagataatatattt
                     BlueWhale  ggagg------g----aggacta-ttacctgt----agtatctacattgcttctggaagataatatacgt
       CommonBottlenoseDolphin  ggagg------g----aggacta-ttacctgt----agtatctacattgcttctggaagataatatacgt
                   BelugaWhale  ggagg------g----aggacta-ttacctgt----agtatctacattgcttctggaagataatatacgt
                           Pig  ggagg------gagaaagaacta-ttacctgt----agtatccacattgcttatgaaggacaatatattt
                FloridaManatee  gaagg------g----atgacta-ttacctgc----agtatctactttgcttctgaaagataatatattt
           GreaterHorseshoeBat  ggagg------g----aggacta-ttacctat----agtatctacattgcttctgaaagagaatatattt
       WesternEuropeanHedgehog  agagg------t----tcgaata-ttacttgt----agtatctacatggtttctaaaagataatata-tt
                    HouseMouse  agagggagggtg----aggaccg-ttacctat----aactgccacattgcttctgggagataatacattt
              ChineseTreeShrew  aaagg------a----aggacta-ttacctgt----agtagcagcattgcttctgaaagatcatatatag
                        Alpaca  gaagg------g----aggactg-ttacttgc----agtagctacatttcttctaaaagataatatattt
             WildBactrianCamel  gaagg------g----aggactg-ttacttgc----agtagctacatttcttctgaaagataatatattt
                  ArabianCamel  gaagg------g----aggactg-ttacttgc----agtagctacatttcttctgaaagataatatattt
                    MinkeWhale  ggagg------g----aggacta-ttacctgt----agtatctaccttgcttctggaagataatatacgt
                   KillerWhale  ggagg------g----aggacta-ttacctgt----agtatctacattgcttctggaagataatatacgt
                    SpermWhale  ggagg------g----aggacta-ttacctgt----agtatctacattgcttctggaagataatatatgt
                ChacoanPeccary  ggagg------g----agaacta-ttacctgt----agtatccacattgcttctgaaagacaatatattt

     Oar_rambouillet_v1_0_addY  cata-tatttctgt---t---gcagtcagtt----caaacata-----ta----ctcaaggaaagggaga
                        Rabbit  cctacaattcctct---t---tcggtaggct----cgaaagaa-----tactttcacccggaaagggaaa
                         Horse  cata-tattctttt---t---gcagtcagtt----cataacta-----ca----ctcaaggaaagggaga
               ChinesePangolin  tatactattccttt---t---gcagtcagtc----caaaacta-----ta----ctcaaggagagggaga
                         Human  catacaattccttt---t---gcagtcagct----caaaagaa-----tactttctccaggaaagagaaa
                      Aardvark  cataccactccttt---tcacatagccag-------aaaagaa-----tactttctcaaggaaaaggaga
                     BlueWhale  cataccattcctgt---t---gcaggcagtt----caaaacta-----ta----ctcaaggaaaggggga
       CommonBottlenoseDolphin  cataccattcctgt---t---gcaggcagtt----caaaacta-----ta----ctcaaggaaagtggga
                   BelugaWhale  cataccattcctgt---t---gcaggcagtt----caaaacta-----ta----ctcaaggaaagcggga
                           Pig  cataccattcctat---t---acaatcagtt----caaaagta-----ta----cacaaggaaagggaga
                FloridaManatee  catactattccttt---t---tcatgcagat----caaaaagaatacttt----ctcaaggaaaaggaga
           GreaterHorseshoeBat  cagaccattccctt---t---gcagtt--------taaaatta-----ta----gtcaagaaaagggaga
       WesternEuropeanHedgehog  catgccacaccttcacaa---tcaatg--------caaaagct-----ta----ctcaagaaaagggaga
                    HouseMouse  caggcagttcctgt---t---------------------tgag-----tt----ctccgaaaagcaa-gt
              ChineseTreeShrew  cacacaatttcttt---t---gcaatggtctcgaaagaatact-----tt----ctccaggaaacggtga
                        Alpaca  catatctttcctgt---t---gcagtcagtt----gaaaacta-----ta----ctcaaggaaagggaga
             WildBactrianCamel  catatctttcctgt---t---gcagtcagtt----gaaaacta-----ta----ctcaaggaaagggaga
                  ArabianCamel  catatctttcctgt---t---gcagtcagtt----gaaaacta-----ta----ctcaaggaaagggaga
                    MinkeWhale  cataccattcctgt---t---gcaggcagtt----caaaacta-----ta----ctcaaggaaaggggga
                   KillerWhale  cataccattcctgt---t---gcaggcagtt----caaaacta-----ta----ctcaaggaaagtggga
                    SpermWhale  cataccattcctgt---t---gcaggcagtt----caaaacta-----ta----ctcaaggaaaggggga
                ChacoanPeccary  cataccattcctat---t---gcaatcagtt----caaaacta-----ta----cacaaggaaagggaga

     Oar_rambouillet_v1_0_addY  caggcacctcaacagagaaagcatgaccaggaagatttttgtgccg------tgtgtctgcgaactggct
                        Rabbit  cagacaccttgacagagaaggcacggcaagaatgattttgaggcca------tgtgtctgtgatcttgct
                         Horse  cagacaccttcacagagaaggcatgacacggaaga-ttctgtgcca------tgtgtctgcgatcctgct
               ChinesePangolin  tgggctccttaacagagaaggcatgacaaggaggg-ttttgtgccatgtgtctgtgtctgtgatcttgct
                         Human  caggcaccttgacagagaaggcatggcaagaaaaa-ttttgtgtta----------cctgttatcttgct
                      Aardvark  caggcaccttaacagagaaggcaggacaagaaaga-ttttgtgcca----------tgtgcctgcatgt-
                     BlueWhale  caggcaccttaacagagaaggcatgacaagaaagagttttgtgcca------tatgtctgtgatcttgct
       CommonBottlenoseDolphin  caggcaccttaacagagaaggcatgacaagaaagagttttgtgcca------tatgtctgtgatcttgct
                   BelugaWhale  caggcaccttaacagagaaggcatgacaagaaagagttttgtgcca------tatgtctgtgatcttgct
                           Pig  caggcaccttaacagagaaggcatgacaagaaagatttttgtgcca------tgtgtctgtgattttgct
                FloridaManatee  caggcaccttaacagagaaggcataagaagaaaga-ttttgtgcca------tgtgtctg------tgct
           GreaterHorseshoeBat  cagggaccttaagagagaaggcatgacaagaaagattt-tgtgcca------tgagtctgtgatcttgct
       WesternEuropeanHedgehog  caggcacgttaacagagaaggcaagac----aagatct-tgtgcca------agcgtctgaaatcttgtt
                    HouseMouse  caggtagccttagagagcaggcagaacacgaaagatttctgtgcca------tgtgtctgagatcttgct
              ChineseTreeShrew  caggcaccttggaggagaaggcatggcaagaaagattg-tatacca------tgtgtctgcaatcttgct
                        Alpaca  caggcaccttaacagagaaggcatgacaagaaagatttttgtgcca------tgtgtctgtgatcttgct
             WildBactrianCamel  caggcaccttaacagagaaggcatgacaagaaagatttttgtgcca------tgtgtctgtgatcttgct
                  ArabianCamel  caggcaccttaacagagaaggcatgacaagaaagatttttgtgcca------tgtgtctgtgatcttgct
                    MinkeWhale  caggcaccttaacagagaaggcatgacaagaaagagttttgtgccg------tatgtctgtgatcttgcg
                   KillerWhale  caggcaccttaacagagaaggcatgacaagaaagagttttgtgcca------tatgtctgtgatcttgct
                    SpermWhale  caggcaccttagcagagaaggcatgacaagaaagagttttgtgcca------tatgtctgcgatcttgct
                ChacoanPeccary  ctggcaccttaacagagaaggcatgacaagaaagatttttgtgcca------cgtgtctgtgatcttgct

     Oar_rambouillet_v1_0_addY  tta-t-g-------ctacccactttagac--tg--gactcagaacagtttcaaaatactggttttctt--
                        Rabbit  ttaac-acagttctttgtaagctttaaac--tg--gactcaaaacagtttcatagtattgtttccctt--
                         Horse  tta-c-ccagtgctttatctactttaaac--ag--ga--cacaacagtttcaaaatattgttctcctt--
               ChinesePangolin  tta-c-atagtgctttatacacttggaac--tg--gatttgaaatagtttcaaaatattgttttcctt--
                         Human  ttaat-acaatgctttatatactttaaac--aa--gactccaaacagttttaaaatattatttccctt--
                      Aardvark  ----t-gcagtgctttctacactttaaaccaaa--ggctcaaaacagtttcaaaatactgttttcctt--
                     BlueWhale  tta-t-agagtgctttacccactttaaac--tg--gactcaaaacagtttcaaaatattgtttttctt--
       CommonBottlenoseDolphin  tta-t-agagtggtttacccactttaaac--tg--gactcaaaacagtttcaaaatactgtttttctt--
                   BelugaWhale  tta-t-agagtggtttacccactttaaac--tg--gactcaaaacagtttcaaaatactgtttttctt--
                           Pig  tta-t-acagtgctttacccactttaaac--ta--gactcaaaacagtttcaaaatattattcttctt--
                FloridaManatee  tta-t-acagtgctttatgcattttaaac--tgaaggctcaaaacagtttcaaaatactgctttcctt--
           GreaterHorseshoeBat  tta-c-acagtgctttatacactttaaac--tg--gacttgaagcagtttcaaaatactgttttcct---
       WesternEuropeanHedgehog  taa-a-acagggcttcatacactttaaac--tg--gacatacaacagctttaaaatactgctttcccctc
                    HouseMouse  tta-ataccatgctttaaacacttaaaac--ca--gacatgacacagtttcaaacca----gcccttt--
              ChineseTreeShrew  tta-atacaatgctttctacacattgaac--ca--aactagaaacagtttcaaaatactgttttcttt--
                        Alpaca  tta-t-------------ccactttaaac--tg--gacacaaaatagtttcaaagtattgtctttctt--
             WildBactrianCamel  tta-t-------------ccactttaaac--tg--gacacaaaacagtttcaaagtattgtctttctt--
                  ArabianCamel  tta-t-------------ccactttaaac--tg--gacacaaaacagtttcaaagtattgtctttctt--
                    MinkeWhale  tta-t-agagtgctttacccactttaaac--tg--gactcaaaacagtttcaaaatattgtttttctt--
                   KillerWhale  tta-t-agagtggtttacccactttaaac--tg--gactcaaaacagtttcaaaatactgtttttctt--
                    SpermWhale  tta-t-agagtggtttacccactttaaac--tg--gactcaaaacagtttcaaaatattgtttttctt--
                ChacoanPeccary  tta-t-acagtgctttatccactttaaac--tg--gaatcaaaacagtttggaaatattgttcttctt--

     Oar_rambouillet_v1_0_addY  -------attaagtaactaggttataaggcaacaaacaaatttcctttaagactgtgctatcagataatc
                        Rabbit  -------attcagtaatcagattacagtgcaacaaataattttcctttaagaatttcctaccaaatagtg
                         Horse  -------attaagtaatcaggttataatgcaccaaataattttcctttatgactctgctatcaaatagtc
               ChinesePangolin  -------attgagcaagcaggctataatgcaacaaataatttttcttgaagtctctgctatcagatagtc
                         Human  -------attaagtaatcaggttacaatgcagcaaagaatttccatttaagactctgctatcaaataggt
                      Aardvark  -------attaagcaatcaggttataatgcaataaataatttttctttaagacactgctatcatatagaa
                     BlueWhale  -------attaagtaattaggttataatgcaatgaataattttcctttaagactgtgctatcagataatc
       CommonBottlenoseDolphin  -------attaagtaattaggttataatgcaacgaataattttcctttaagactgtgctatcagataatc
                   BelugaWhale  -------attaagtaattaggttataatgcaacgaataattttcctttaagactgtgctatcagataatc
                           Pig  -------attaagtaattaggctataatgcaacaaataatttttcttgaaaactatgctatcagataatc
                FloridaManatee  -------attaagcagtcaggttacaatgcaacaaatagttttcctttaagaccctgccatcaaatagtc
           GreaterHorseshoeBat  -------tctaagtaagcaa------------caaataattttcctttaagaccctg-tctcagatagtc
       WesternEuropeanHedgehog  ttacagatttaaattataaagt----------cacacaa-tttcctttaagactctgctgtcaaatagtc
                    HouseMouse  -------cctaagcggtcaggttacgatacagcagataattttcatttatgactcttggatcaaacagtt
              ChineseTreeShrew  -------attaagtaatcaggttacagtgtaacatataatttggatttaggactctgccatcaagtagtt
                        Alpaca  -------attaagtaattaggttataatgcaacaaataattttcctttaagactgtgctatca-atagtc
             WildBactrianCamel  -------attaagtaattaggttataatgcaacaaataattttcctttaagactgtgctatcagatagtc
                  ArabianCamel  -------attaagtaattaggttataatgcaacaaataattttcctttaagactgtgctatcagatagtc
                    MinkeWhale  -------attaagtaattaggttataatgcaacgaataattttcctttaagactgtgctatcagataatc
                   KillerWhale  -------attaagtaattaggttataatgcaacgaataattttcctttaagactgtgctatcagataatc
                    SpermWhale  -------attaagtaattaggttataatgcaacgaataattttcctgtacgactgtgctatcagataatc
                ChacoanPeccary  -------attaagtaattaggctatgatgcaacaaataatttttcttgaagactgtgctatcagataatc

     Oar_rambouillet_v1_0_addY  ctggaatagatttgccttatttataaacaatct---tgagaaaacaaaaaggcaagaa--attgctaagt
                        Rabbit  ctggagtagattgaccttatttatcaatgattt---tt-gaaagcca-----aaagaa--tttgtt-cat
                         Horse  ctggagtagatttaccttatttataaacaatct---tg-gggaaccaaaataaaagaa--attgct-agt
               ChinesePangolin  ctggagtagatttgccttacttatagataatct---tg-gaaaaccaaaaggaaataa--attgc--agg
                         Human  ctggagcagatttacct--tttatagacaattt---tg-gaaaaccaaaataaaagaa--attgtt-agt
                      Aardvark  ctgtagaagattcaccttatttacagacaaatt---tg-gaaaattaaaagaaaagaa--attgct-aat
                     BlueWhale  ctggagtagatttgccttatttataaacaatct---tg-gaaaaccaaaaggaaagaa--atttctaagt
       CommonBottlenoseDolphin  ctggagtagatctgccttatttataaacaatct---tg-gaaaaccaaaaggaaagaa--atttctaagt
                   BelugaWhale  ctggagtagatttgccttatttataaacaatct---tg-gaaaaccaaaaggaaagaa--atttctaagt
                           Pig  ctagagtagatttgccttatttataaacaatct---tg-gaaaaccaaaaggaaagct--gtttctaaat
                FloridaManatee  ctgtagtagatttgccttatttgcagacaaatt---ta-gaaaatcaaaaggaaagga--attgtt-agt
           GreaterHorseshoeBat  ctggagaagattttccttatttataaacaatct---tggaaaaaccaagagg-aaagaa-atttctaagt
       WesternEuropeanHedgehog  ctgtaattgcttcaccttactgatttataagctctacaagaacaccaaaatg-ca---------ctgagt
                    HouseMouse  caggaaaaagtctcccttatttacatg-gggtt---tggaaaagc---------------aattgttagt
              ChineseTreeShrew  ctggagtagctttatcttatttgtagacaattt---tggaaaagcaaaggga-aagaagaaattgtaagt
                        Alpaca  ctggagtagatctgccttatttataaacagtca---tggaaaaccaaaagga-aagaa--atttctaagt
             WildBactrianCamel  ctggagtagatctgccttatttataaataatca---tggaaaaccaaaagga-aagaa--atttttaagt
                  ArabianCamel  ctggagtagatctgccttatttataaataatca---tggaaaaccaaaagga-aagaa--atttttaagt
                    MinkeWhale  ctggagtaggtttgccttctttataaacaatct---tggaaaaccaaaagga-aagaa--atttctaagt
                   KillerWhale  ctggagtagatctgccttatttataaacaatct---tggaaaaccaaaagga-aagaa--atttctaagt
                    SpermWhale  ctggagtagatttgccttatttataaacaatct---tggaaaaccaaaagga-aagaa--atttctaagt
                ChacoanPeccary  ctagagtagatttgccttatttataaacaatct---tggaaaaccaaaagga-aagtg--gtttctaagt

     Oar_rambouillet_v1_0_addY  gcttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaa
                        Rabbit  gcttgtctttagaatgacagctcagacataaaggca---------aacttttgagacagcctgaatataa
                         Horse  gattttgctcacaatgacagcctggctctaaagacagtattttctaacttttgagatagcctgaatataa
               ChinesePangolin  gcttctgtttgtaatgacagcctgaccctaaagataacattttctaacttttgagaaagccaaaatccaa
                         Human  gcttgtgcttac-atgacagcctggccctaaagacaatactttcgaacttttcagatagcctgaatataa
                      Aardvark  gtctctgcttgcaatgatagcatgggcctaaagacagaactttctaactactaaga-atctcgaatgtaa
                     BlueWhale  gcttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgagagagcctgaacgcaa
       CommonBottlenoseDolphin  gcttctgcttacaatgacagcctggccctaaagacagtgttttctaagttttgagatagcctgaatgcaa
                   BelugaWhale  gcttctgcttacaatgacagcctggccctaaaggcagtgttttctaagttttgagatagcctgaatgcaa
                           Pig  gcttctgcttacaatgacagcatggccttaa---caatgttttctaagttttgagatagcctgaatgcaa
                FloridaManatee  gtctctgcttacaatgacagcctgattctaaaaacaatactttctaacttttgagctatcttgaata-aa
           GreaterHorseshoeBat  gcttctgcttacactgacagcctggcacgaaagacagtattttctaaattttgagatagtctgaatgtaa
       WesternEuropeanHedgehog  gttcctgcttaca-----agtctccccagaaagccctgaagttctagcttttcagatagcctgaatataa
                    HouseMouse  gc-tgaacttgcagtgagaggctggccccaaggccactgctttctgattttttagatagcttgagcatga
              ChineseTreeShrew  gcttgtactttcagc------ctggccctcaagacaatgctttttaacttttgagaaggcctaaatataa
                        Alpaca  gtttctccttacaatgacagcctgcccctaaagacaatgttctctaacttttaagatagcctgaatgcga
             WildBactrianCamel  gtttctccttacaatgacagcctgcccctaaagacaatgttctctaacttttgagatagcctgaatgcga
                  ArabianCamel  gtttctccttacaatgacagcctgcccctaaagacaatgttctctaacttttgagatagcctgaatgcga
                    MinkeWhale  gcttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgagagagcctgaatgcaa
                   KillerWhale  gcttctgcttacaatgacagcctggccctaaagacagtgttttctaagttttgagatagcctgaatgcaa
                    SpermWhale  gcttctgcttacaatgacagcctggccctaaagacagtgttttctaagttttgagatagcctgaatgcaa
                ChacoanPeccary  gtttctgcttacaatgacagcatggcctta---acaatgttttctaagttttgagatagcctgaatgcaa

     Oar_rambouillet_v1_0_addY  catcga---aat-tttggtgccaattacctgct-agtt
                        Rabbit  catc-a---aac-ttctctcctaattacttgc------
                         Horse  cattca---aat-ttttgtgctaattacttgc------
               ChinesePangolin  cattta---aatgttttgtactaattacctac------
                         Human  catcaa---aat-ttttgtgttaattatctgc------
                      Aardvark  cagcta---cac-ttttgtgataattacctgc------
                     BlueWhale  cattta---gat-tttggtgctacttacctgc------
       CommonBottlenoseDolphin  cattta---gat-tttggtgctacttacctgc------
                   BelugaWhale  cattta---gat-tttggtgctacttacctgc------
                           Pig  cattta---aat-tctggtgctaagtgccttc------
                FloridaManatee  cagcta---tat-ttttgtgataattacctac------
           GreaterHorseshoeBat  cattta---cat-tttggtgctaattacctgcttag--
       WesternEuropeanHedgehog  cttttaattttt-tttggctctaattacctgcttaa--
                    HouseMouse  cctctg---agg-tttt-tgctaattaagtttt-----
              ChineseTreeShrew  catctg---aat-ttttgtgctaattacctgctcac--
                        Alpaca  cattta---aat-tttggtgctaattagctgct-cg--
             WildBactrianCamel  cattta---aat-tttggtgctaattagctgct-ag--
                  ArabianCamel  cattta---aat-tttggtattaattagctgct-ag--
                    MinkeWhale  cattta---gat-tttggggctacttacctgct-ag--
                   KillerWhale  cattta---gat-tttggtgctacttacctgct-ag--
                    SpermWhale  cattta---gat-tttggtgctacttacctgct-ag--
                ChacoanPeccary  cattta---aat-tctgctgctaactgccttct-ag--

Alignment block 25 of 177 in window, 129060860 - 129060954, 95 bps 
B D  Oar_rambouillet_v1_0_addY  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                 JavaMouseDeer  tactattgctgagagtacctagcctgtatatttccaggcaggcacatgcttaataatcttctaa---aag
                         Bongo  tactattgttgagagtacctggtctgcacatatcttgg-aggcacatgattattaaccttctaa---aat
                         Saiga  tactattgttgagagtgcctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                         Gayal  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                    LesserKudu  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgattattaaccttctaa---agt
                     Sitatunga  tactattgttgagagtacctggtctgcacatatcttgg-aggcacatgattattaaccttctaa---aat
                 MountainNyala  tactattgttgagagtacctggtctgcacatatcttgg-aggcacatgattattaaccttctaa---aat
                AlpineMuskDeer  tactgttgttgagagtacctggtctgcacatatctagg-aggcacatgtttaataaccttctaa---aat
                WesternRoeDeer  tactattgttgagtgtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                          Gaur  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                 AmericanBison  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                       WildYak  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                   DomesticYak  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                  WaterBuffalo  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                AfricanBuffalo  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---agt
                   CommonEland  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgattattaaccttctaa---aat
                   GreaterKudu  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgattattaaccttctaa---aat
                      Bushbuck  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgattattaaccttctaa---aat
                        Impala  tactattgttgagagtacctggtctgcacatatctagg-agacacatgcttaataaccttctaa---aat
                          Suni  tactattgttgagagtacctggtctgcacatatctagg-tggcac---cttaataaccttctaa---aat
                  Klipspringer  tactgttgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaaaataat
                 RoyalAntelope  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                   KirksDikDik  tactattgttgacagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                      Steenbok  tactattgttgagagtacctggtctgcacatttctagg-aggcacatgcttaataaccttctaa---aat
            PrzewalskisGazelle  tgctattgttgagagtgcctggtctgcacgtatctagg-aggcacatgcttaataaccttctaa---cat
                         Oribi  tactattgttgagagtgcctggtctgcacatacctagg-aggcacatgcttaataacctgctaa---aat
               ThomsonsGazelle  tactattgttgagagtgcctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                       Gerenuk  tactattgttgagagtgcctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                     Springbok  tactattgttgagagtgcctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                MaxwellsDuiker  tactattgtt--gagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aac
                 HarveysDuiker  tactattgtt--gagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aac
                 BohorReedbuck  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaacaaccttctaa---aat
              DefassaWaterbuck  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaacaaccttctaa---aat
                        Lechwe  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaacaaccttctaa---aat
                       Gemsbok  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
            ScimitarHornedOryx  tactattgttgagagtacctggtctgcatatatctagg-aggcacatgcttaataaccttctaa---aat
                  RoanAntelope  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                 SableAntelope  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                BlueWildebeest  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                          Topi  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                        Herola  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
               TibetanAntelope  tactattgttgagagtacctggtctgcacttatctagg-aggcacatgcttaataacctcctaa---aat
                  MountainGoat  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
               EuropeanMouflon  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                AsiaticMouflon  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                     SnowSheep  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                  BighornSheep  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                  BarbarySheep  tactattgttgagagtacctggtctgcacatatctggg-aggcacatgcttaataaccttctaa---aat
                        Bharal  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                   NilgiriTahr  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
B D                       ARS1  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                      WildGoat  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                  SiberianIbex  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
         ChineseForestMuskDeer  tactgttgttgagagtacctggtctgcacatatctagg-aggcacatgtttaataaccttctaa---aat
                  BlackMuntjac  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                 IndianMuntjac  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                 ReevesMuntjac  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                PereDavidsDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatacttaataaccttctaa---aat
               WhiteLippedDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                   YarkandDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                       RedDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                       HogDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
               WhiteTailedDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                      MuleDeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                      Reindeer  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---act
                EasternRoeDeer  tactattgttgagtgtacctggtctgcacatatccagg-aggcacatgcttaataaccttctaa---aat
                   EurasianElk  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
              ChineseWaterDeer  tactattgttgagtgtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                       Giraffe  tactattgttgagagtacctggtctgcacctatctagg-aggcacatgcttaataaccttctaa---aat
                     Pronghorn  tactattgttgagagtacctggtctgcacgtatctagc-aggcacatgcttaataaccttctaa---aat
                        Cattle  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                    ZebuCattle  tactattgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
              SiberianMuskDeer  tactgttgttgagagtacctggtctgcacatatctagg-aggcacatgcttaataaccttctaa---aat
                         Okapi  tactattgttgagagtacctggtctgcacctatctagg-aggcacatgcttaataaccttctaa---aat

     Oar_rambouillet_v1_0_addY  attatttgattcctcataggagggagaac
                 JavaMouseDeer  attattttattcttcatgggagggaggac
                         Bongo  attattttattcctcatagaagggagaac
                         Saiga  attattttattcctcataggagggagaac
                         Gayal  attattttattcctcataggagggagaac
                    LesserKudu  attattttattcctcatagaagggagaac
                     Sitatunga  attattttattcctcatagaagggagaac
                 MountainNyala  attattttattcctcatagaagggagaac
                AlpineMuskDeer  attattttattccttataggagggagaac
                WesternRoeDeer  attattttattccttatagaagggagaac
                          Gaur  attattttattcctcataggagggagaac
                 AmericanBison  attattttattcctcataggagggagaac
                       WildYak  attattttattcctcataggagggagaac
                   DomesticYak  attattttattcctcataggagggagaac
                  WaterBuffalo  attattttattcctcataggagggagaac
                AfricanBuffalo  attattttattcctcataggagggagaac
                   CommonEland  attattttattcctcatagaagggagaac
                   GreaterKudu  attattttattcctcatagaagggagaac
                      Bushbuck  attattttattcctcatagaagggagaac
                        Impala  attattttattcctcataggagggagaac
                          Suni  attattttattcctcataggagggagaac
                  Klipspringer  attattttattccttataggagggagaac
                 RoyalAntelope  attattttattcctcataggagggagaac
                   KirksDikDik  attattttattcctcataggagggagaac
                      Steenbok  attattttattcctcataggagggagaac
            PrzewalskisGazelle  attattttattcctcatacgagggagagc
                         Oribi  attattttattcctcataggagggagaac
               ThomsonsGazelle  attattttattcctcataggagggagaaa
                       Gerenuk  attattttattcctcataggagggagaac
                     Springbok  attattttattcctcacaggagggagaac
                MaxwellsDuiker  attattttattcctcata-gagggagaac
                 HarveysDuiker  attattttattcctcata-gagggagaac
                 BohorReedbuck  att-ttttattcctcataggagggagaac
              DefassaWaterbuck  att-ttttattcctcataggagggagaac
                        Lechwe  att-ttttattcctcataggagggagaac
                       Gemsbok  attattctattcctcataggagggataac
            ScimitarHornedOryx  attattctattcctcataggagggataac
                  RoanAntelope  attattctattcctcataggagggataac
                 SableAntelope  attattctattcctcataggagggataac
                BlueWildebeest  attattttattcctcataggagggagaac
                          Topi  attattttattcctcataggagggagaat
                        Herola  attattttattcctcataggagggagaac
               TibetanAntelope  attattttattcctcataggagggagaac
                  MountainGoat  ataattttattcctcataggagggagaac
               EuropeanMouflon  attatttgattcctcataggagggagaac
                AsiaticMouflon  attatttgattcctcataggagggagaac
                     SnowSheep  attatttgattcctcataggagggagaac
                  BighornSheep  attatttgattcctcataggagggagaac
                  BarbarySheep  attattttattcctcataggagggagaac
                        Bharal  attattttattcctcataggagggagaac
                   NilgiriTahr  attatttgattcctcataggagggagaac
                          ARS1  attattttattcctcataggagggagaac
                      WildGoat  attattttattcctcataggagggagaac
                  SiberianIbex  attattttattcctcataggaggaagaac
         ChineseForestMuskDeer  attattttattccttataggagggagaac
                  BlackMuntjac  attattttattccttataggagggagaac
                 IndianMuntjac  attattttattccttataggagggagaac
                 ReevesMuntjac  attattttattccttataggagggagaac
                PereDavidsDeer  attattttattccttataggagggagaac
               WhiteLippedDeer  attattttattcctcataggagggagaac
                   YarkandDeer  attattttattccttataggagggagaac
                       RedDeer  attattttattccttataggagggagaac
                       HogDeer  attattttattccttataggagggagaac
               WhiteTailedDeer  attattttattccttataggagggagaac
                      MuleDeer  attattttattccttataggagggagaac
                      Reindeer  attattttattccttataggagggagaac
                EasternRoeDeer  attattttattccttatagaagggagaac
                   EurasianElk  attattttattccttataggagggagaac
              ChineseWaterDeer  attattttattccttatagaagggagaac
                       Giraffe  attgttttattccttataggatggagaac
                     Pronghorn  attattttattccttataggagggagaac
                        Cattle  attattgtattcctcataggagggagaac
                    ZebuCattle  attattttattcctcataggagggagaac
              SiberianMuskDeer  attattttattccttataggagggagaac
                         Okapi  attattttatttcttataggagggagaac

Alignment block 26 of 177 in window, 129060955 - 129060971, 17 bps 
B D  Oar_rambouillet_v1_0_addY  tattacctgtatgtag---t
                 JavaMouseDeer  tgttacctgtatgtagtatt
                         Bongo  tattgcctgtatgtag---t
                         Saiga  tattacctgtatgtag---t
                         Gayal  tattacctatatgtag---t
                    LesserKudu  tattgcctatatgtag---t
                     Sitatunga  tattgcctgtatgtag---t
                AlpineMuskDeer  tattacctgtatgtag---t
                WesternRoeDeer  tattacctgtatgtag---t
                          Gaur  tattacctatatgtag---t
                 AmericanBison  tattacctatatgtag---t
                       WildYak  tattacctatatgtag---t
                   DomesticYak  tattacctatatgtag---t
                  WaterBuffalo  tattacctatatgtag---t
                AfricanBuffalo  tattacctgtatgtag---t
                   CommonEland  tattgcctatatgtag---t
                   GreaterKudu  tattgcctatatgtag---t
                      Bushbuck  tattgcctatatgtag---t
                        Impala  tattacctgtatgtag---t
                          Suni  tattatgtgtatgtag---t
                  Klipspringer  tattacctgtatgcag---t
                 RoyalAntelope  tattacctgtatgtag---t
                   KirksDikDik  tattacctgtatgtag---t
                      Steenbok  tattacctgtatgtag---t
            PrzewalskisGazelle  tattacctgtatgtag---t
                         Oribi  tattacctgtatgtag---t
               ThomsonsGazelle  tattacctatatgtag---t
                       Gerenuk  tattacctgtatgtag---t
                     Springbok  tattacctttatgtag---t
                MaxwellsDuiker  tattacttgtatgtag---t
                 HarveysDuiker  tattacctgtatgtag---t
                 BohorReedbuck  tattaactgtatgtag---t
              DefassaWaterbuck  tattaactgtatgtag---t
                        Lechwe  tattaactgtatgtag---t
                       Gemsbok  tattacctgtatgtag---t
            ScimitarHornedOryx  tattacttgtatgtag---t
                  RoanAntelope  tattacctgcatatag---t
                 SableAntelope  tattacctgcatatag---t
                BlueWildebeest  tattacctgtatgtag---t
                          Topi  tattacctgtatgtag---t
                        Herola  tattacctgtatgtag---t
               TibetanAntelope  tattacctgtatgtag---t
                  MountainGoat  tattacctgtatgtag---t
               EuropeanMouflon  tattacctgtatgtag---t
                AsiaticMouflon  tattacctgtatgtag---t
                     SnowSheep  tattacctgtatgtag---t
                  BighornSheep  tattacctgtatgtag---t
                  BarbarySheep  tattacctgtatgtag---t
                        Bharal  tattacctgtatgtag---t
                   NilgiriTahr  tattacctgtatgtag---t
B D                       ARS1  tattacctgtatgtag---t
                      WildGoat  tattacctgtatgtag---t
                  SiberianIbex  tattacctgtatgtag---t
         ChineseForestMuskDeer  tattacctgtatgtag---t
                  BlackMuntjac  tatcacctgtatgtac---t
                 IndianMuntjac  tatcacctgtatgtac---t
                 ReevesMuntjac  tatcacctgtatgtac---t
                PereDavidsDeer  tattacctgtatgtag---t
               WhiteLippedDeer  tattacctgtatgtag---t
                   YarkandDeer  tattacctgtatgtag---t
                       RedDeer  tattacctgtatgtag---t
                       HogDeer  tattacctgtatgtag---t
               WhiteTailedDeer  tattacctgtatgtag---t
                      MuleDeer  tattacctgtatgtag---t
                      Reindeer  tattacctgtatgtag---t
                EasternRoeDeer  tattacctgtatgtag---t
                   EurasianElk  tattacct-------g---t
              ChineseWaterDeer  tattacctgtatgtag---t
                       Giraffe  tattacctgtatgtag---t
                     Pronghorn  tattacctgtatgtgg---t
                        Cattle  tattacctatatgtag---t
                    ZebuCattle  tattacctatatgtag---t
              SiberianMuskDeer  tattacctgtatgtag---t
                         Okapi  tattacctgtatgtag---t

Alignment block 27 of 177 in window, 129060972 - 129061073, 102 bps 
B D  Oar_rambouillet_v1_0_addY  atctatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                 JavaMouseDeer  atctatgttgtttctgaaagataatatatttcacaccattttcgttgcagtcagttcaaaactctactc-
                         Bongo  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                         Saiga  atctatgttgtttctggaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                         Gayal  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                    LesserKudu  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                     Sitatunga  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                AlpineMuskDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgatgcagtcagttcaaacctatactca
                WesternRoeDeer  atctgtgttgtttctgaaagatagtatgtttcataccatttctgttgcaggcaattaaaacctataccca
                          Gaur  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                 AmericanBison  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                       WildYak  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                   DomesticYak  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                  WaterBuffalo  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                AfricanBuffalo  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                   CommonEland  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                   GreaterKudu  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctacactca
                      Bushbuck  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                        Impala  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaagctatactca
                          Suni  atctatgttgtttctgaaagataatatgtttcata-tgtttctgttgtggtcagttcaaacctatattca
                  Klipspringer  atctatgttgtttctgaaagataatatgtttcata-tctttctgtggcaggcagttcaaacctatactca
                 RoyalAntelope  atctgtgttgtttctgaaagataatatgtttccta-tatttctgttgcagtcagttcaaacctatactc-
                   KirksDikDik  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatattca
                      Steenbok  atctatgttgtttctgaaagatgatatgtttcata-tatttctgttgcaatcagttcaaacctatactca
            PrzewalskisGazelle  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttc-aacctatactca
                         Oribi  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
               ThomsonsGazelle  atctatgttgtttctggaagataatatgtttcata-tatttctgttgcagtcagctcaaacctatactca
                 GrantsGazelle  atctatgttgtttctggaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                       Gerenuk  atctatgttgtttctggaagataatatgtttcatc-tatttctgttgcagtcagttcaaacctatactca
                     Springbok  atctatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                MaxwellsDuiker  atctatgttgtttctgaaagataatatgttttgta-tatttctgttgcagtcagttcaaacctatactca
                 HarveysDuiker  atctatgttgtttctgaaagataatatgttttgta-tatttctgttgcagtcagttcaaacctatactca
                 BohorReedbuck  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
              DefassaWaterbuck  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctctactca
                        Lechwe  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                       Gemsbok  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
            ScimitarHornedOryx  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                  RoanAntelope  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                 SableAntelope  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                BlueWildebeest  atctatgttgtttctgaaagatgatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                          Topi  atctatgttgtttctgaaagatgatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                        Herola  atctatgttgtttctgaaagatgatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
               TibetanAntelope  atctatgttgtttctgaaagataatatgtttcata-catttctgttggagtcagttcaaacatatactca
                  MountainGoat  atctttgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
               EuropeanMouflon  atctatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                AsiaticMouflon  atctatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                     SnowSheep  atctatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                  BighornSheep  atccatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                  BarbarySheep  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                        Bharal  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                   NilgiriTahr  atctatattgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
B D                       ARS1  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                      WildGoat  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
                  SiberianIbex  atctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacatatactca
         ChineseForestMuskDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgatgcagtcagttcaaacctatactca
                  BlackMuntjac  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
                 IndianMuntjac  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
                 ReevesMuntjac  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
                PereDavidsDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
               WhiteLippedDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
                   YarkandDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
                       RedDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
                       HogDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgttgcaggcagttaaaacctatactca
               WhiteTailedDeer  atctgtgttgtttctgaaagatagtatgtttcataccatttctgttgcaggcagttaaaacctatactca
                      MuleDeer  atctgtgttgtttctgaaagatagtatgtttcataccatttctgttgcaggcagttaaaacctatactca
                      Reindeer  atctgtgttgtttctgaaagatagtatgtttcatgccatttctgttgcaggcagttaaaacctatactca
                EasternRoeDeer  atctgtgttgtttctgaaagatagtatgtttcataccatttctgttgcaggcaattaaaacctataccca
                   EurasianElk  atctgtgttgtttctgaaagatagtatgtttcataccatttctgttgcaggcagttaaaatttatactca
              ChineseWaterDeer  atctgtgttgtttctgaaagatagtatgtttcataccatttctgttgcaggcaattaaaacctatactca
                       Giraffe  atctatgctgtttctgaaagataatatgtttcacaccatttctgttgcagtcagttcaaacctatactca
                     Pronghorn  atctatgttgtttctgaaagataatctgcttcataccatttctgttgcagtcagtt-aaacctatactca
                        Cattle  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcagttcaaacctatactca
                    ZebuCattle  acctatgttgtttctgaaagataatatgtttcata-tatttctgttgcagtcaattcaaacctatactca
              SiberianMuskDeer  atctatgttgtttctgaaagataatatgtttcataccatttctgatgcagtcagttcaaacctatactca
                         Okapi  atctatgttgtttctgaaagataatatgtttcacaccatttctgttgcagtcagttcaaacctatactca

     Oar_rambouillet_v1_0_addY  aggaaagggagac-aggcacc-tcaacagagaaag
                 JavaMouseDeer  aggaaagggagac-aggcacctttagcagagaagg
                         Bongo  aggaaagggagac-aggcacc-tcaacagagaagg
                         Saiga  aggaaagggagac-aggcacc-tcaacagagaagg
                         Gayal  aggaaagggagac-aggcacc-tcaacagagaagg
                    LesserKudu  aggaaagggagac-aggcacc-tcaacagagaagg
                     Sitatunga  aggaaagggagac-aggcacc-tcaacagagaagg
                AlpineMuskDeer  aggaaagggagac-aggcacc-ttaacagagaagg
                WesternRoeDeer  aggaaagggagaaggggcacc-ctaacagagaagg
                          Gaur  aggaaagggagac-aggcacc-tcaacagagaagg
                 AmericanBison  aggaaagggagac-aggcacc-tcaacagagaagg
                       WildYak  aggaaagggagac-aggcacc-tcaacagagaagg
                   DomesticYak  aggaaagggagac-aggcacc-tcaacagagaagg
                  WaterBuffalo  aggaaagggagac-aggcacc-tcaacagagaagg
                AfricanBuffalo  aggaaagggagac-aggcacc-tcaacagagaagg
                   CommonEland  aggaaagggagac-aggcacc-tcaacagagaagg
                   GreaterKudu  agaaaagggagac-aggcacc-tcaacagagaagg
                      Bushbuck  aggaaagggagac-aggcacc-tcaacagagaagg
                        Impala  aggaaagggagac-aggcacc-tcaacaggggaag
                          Suni  aggaaagggaggc-aggtatc-tcaacagaggagg
                  Klipspringer  aggcaagggagac-aggcacc-tcaacagggaagg
                 RoyalAntelope  aggaaagggagac-aggcacc-tcaacagagaagg
                   KirksDikDik  aggaaagggagac-aggcacc-tccacagagaagg
                      Steenbok  agggaagggagac-aggcacc-tcaacagagaagg
            PrzewalskisGazelle  aggaaagggagac-aggcacc-tcaacagagaagg
                         Oribi  aggaaagggagac-aggcacc-tcaacagagaagg
               ThomsonsGazelle  aggaaagggagac-aggcacc-tcaacagagaagg
                 GrantsGazelle  aggaaagggagac-aggcacc-tcaacagagaagg
                       Gerenuk  aggaaagggagac-aggcacc-tcaacagagaagg
                     Springbok  aggaaagggagac-aggcacc-tcaacagagaagg
                MaxwellsDuiker  aggaaagggagac-aggcacc-tcaacagagaagg
                 HarveysDuiker  aggaaagggagac-aggcacc-tcaacagagaagg
                 BohorReedbuck  aggaaagggagac-aggcacc-tcaacagagaagg
              DefassaWaterbuck  aggaaagggagac-aggcacc-tcaacagagaagg
                        Lechwe  aggaaagggagac-aggcacc-tcaacagagaagg
                       Gemsbok  aggaaagggagac-aggcacc-tcaacagggaagg
            ScimitarHornedOryx  aggaaagggagac-aggcacc-tcaacagggaagg
                  RoanAntelope  aggaaagggagac-aggcacc-tcaacagggaagg
                 SableAntelope  aggaaagggagac-aggcacc-tcaacagggaagg
                BlueWildebeest  aggaaagggagat-aggcacc-tcaacagagaagg
                          Topi  aggaaagggagat-aggcacc-tcaacagagaagg
                        Herola  aggaaagggagat-aggcacc-tcaacagagaagg
               TibetanAntelope  aggaaagggagac-aggcacc-tcaacagagaaag
                  MountainGoat  aggaaagggagac-aggcacc-tcaacagagaaag
               EuropeanMouflon  aggaaagggagac-aggcacc-tcaacagagaaag
                AsiaticMouflon  aggaaagggagac-aggcacc-tcaacagagaaag
                     SnowSheep  aggaaagggagac-aggcacc-tcaacagagaaag
                  BighornSheep  aggaaagggagac-aggcacc-tcaacagagaaag
                  BarbarySheep  aggaaagggagac-aggcacc-tcaacagagaaag
                        Bharal  aggaaagggagac-aggcacc-tcaacagagaaag
                   NilgiriTahr  aggaaagggagat-aggcacc-tcaacagagaaag
                          ARS1  aggaaagggagac-aggcacc-tcaacagagaaag
                      WildGoat  aggaaagggagac-aggcacc-tcaacagagaaag
                  SiberianIbex  aggaaagggagac-aggcacc-tcaacagagaaag
         ChineseForestMuskDeer  aggaaagggagac-aggcacc-ttaacagagaagg
                  BlackMuntjac  aggaaagggagac-aggcacc-ctaacagagaagg
                 IndianMuntjac  aggaaagggagac-aggcacc-ctaacagagaagg
                 ReevesMuntjac  aggaaagggagac-aggcacc-ctaacagagaagg
                PereDavidsDeer  aggaaagggagac-aggcacc-ctaacagagaagg
               WhiteLippedDeer  aggaaagggagac-gggcacc-ctaacagagaagg
                   YarkandDeer  aggaaagggagac-gggcacc-ctaacagagaagg
                       RedDeer  aggaaagggagac-gggcacc-ctaacagagaagg
                       HogDeer  aggaaagggagac-gggcacc-ctaacagagaagg
               WhiteTailedDeer  aggaaagggagaaggggcacc-ctaacagagaagg
                      MuleDeer  aggaaagggagaaggggcacc-ctaacagagaagg
                      Reindeer  aggaaagggagaaggggcacc-ctaacagagaagg
                EasternRoeDeer  aggaaagggagaaggggcacc-ctaacagagaagg
                   EurasianElk  aggaaagggagaaggggcacc-ctaacagagaagg
              ChineseWaterDeer  aggaatgggagaaggggcacc-ctaacagagaagg
                       Giraffe  aggaaagggaggc-aggcacc-ttaagagagaagg
                     Pronghorn  gggaaacggaggc-aggcatc-ttaacagagaagg
                        Cattle  aggaaagggagac-aggcatc-tcaacagagaagg
                    ZebuCattle  aggaaagggagac-aggcacc-tcaacagagaagg
              SiberianMuskDeer  aggaaagggagac-aggcacc-ttaacagagaagg
                         Okapi  aggaaagggaggc-aggcacc-ttaagagagaagg

Alignment block 28 of 177 in window, 129061074 - 129061127, 54 bps 
B D  Oar_rambouillet_v1_0_addY  c--atgaccaggaagatttttgtg-ccgtgtg----tctgcgaactggctttatg-------ctaccc
                 JavaMouseDeer  c--atgacaag-aagatttctgtgcccatgtg----gctgtgatctttctgtatgcagtgcttcaccc
                         Bongo  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                         Saiga  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatctggctttata-------ctaccc
                         Gayal  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                    LesserKudu  c--atgaccagaaagagttttgtg-ccatgtg----tctgtgatcttgctttatacagggctctaccc
                     Sitatunga  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                 MountainNyala  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctacct
                AlpineMuskDeer  t--atgacaagaaagatttttgtg-ccatgtg----tctgtgatcttgctttatacagggctctaccc
                WesternRoeDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                          Gaur  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                 AmericanBison  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                       WildYak  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                   DomesticYak  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                  WaterBuffalo  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                AfricanBuffalo  c--atgaccagaaagagttttgtg-tcatgtg----tctgcgatcttgctttatacagggctctaccc
                   CommonEland  c--atgaccagaaagagttttgtg-ccatgtg----tctgtgatcttgctttatacagggctctaccc
                   GreaterKudu  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
                      Bushbuck  c--atgaccagaaagagttttgtg-ccatgtg----tctgtgatcttgctttatacagggctctaccc
                        Impala  c--atgaccagaaagatctttgtg-ccgtgtg----tctgcgatctggctttata-------ctaccc
                          Suni  catatgaccagaaagacttttgtg-ccatgtg----tctgtgatctggctttaca-------ctaccc
                  Klipspringer  c--atgagcagaaagagttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                 RoyalAntelope  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatttggctttata-------ctaccc
                   KirksDikDik  c--atgagcagaaagatttttgtg-ccatgtg----tctgtgatctggctttata-------ctaccc
                      Steenbok  c--aggagcagaaagatttttgtg-ccatgtg----tctgtgatctggctttata-------ctaccc
            PrzewalskisGazelle  c--atgaacagaaagatttttgtg-ccatgtg----tctgagatctggctttata-------ctaccc
                         Oribi  c--atgagcagaaagatttttgtg-ccatgtg----tctgtgatctggctttata-------ctaccc
               ThomsonsGazelle  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatctggctttata-------ctaccc
                 GrantsGazelle  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatctggctttata-------ctaccc
                       Gerenuk  c--atgagcagaaagatttttgtg-ccatgtg----tctgcaatctggctttata-------ctaccc
                     Springbok  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatctggctttata-------ctaccc
                MaxwellsDuiker  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatctggctttata-------ctaccc
                 HarveysDuiker  c--atgagcagaaagatttttgtg-ccatgtg----tctgcgatctggctttata-------ctaccc
                 BohorReedbuck  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
              DefassaWaterbuck  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                        Lechwe  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                       Gemsbok  c--atgaccaggaagatttttgtg-ccatatg----tctgcgatctggctttatg-------ctaccc
            ScimitarHornedOryx  c--atgaccaggaagatttttgtg-ccatatg----tctgcgatctggctttatg-------ctaccc
                  RoanAntelope  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                 SableAntelope  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                BlueWildebeest  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                          Topi  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                        Herola  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
               TibetanAntelope  c--atgaccaggaagatttttgtg-ccatgtg----tctgtgatctggctttatg-------ctaccc
                  MountainGoat  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
               EuropeanMouflon  c--atgaccaggaagatttttgtg-ccgtgtg----tctgcgaactggctttatg-------ctaccc
                AsiaticMouflon  c--atgaccaggaagatttttgtg-ccgtgtg----tctgcgaactggctttatg-------ctaccc
                     SnowSheep  c--atgaccaggaagatttttgtg-ccgtgtg----tctgcgaactggctttatg-------ctaccc
                  BighornSheep  c--atgaccaggaagatttttgtg-ccgtgtg----tctgcgaactggctttatg-------ctaccc
                  BarbarySheep  c--atgaccagggaga-ttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                        Bharal  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                   NilgiriTahr  c--atgaccaggaagatttttgtg-ccgtgtg----tctgcgatctggctttatg-------ctaccc
B D                       ARS1  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                      WildGoat  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
                  SiberianIbex  c--atgaccaggaagatttttgtg-ccatgtg----tctgcgatctggctttatg-------ctaccc
         ChineseForestMuskDeer  t--atgacaagaaagatttttgtg-ccatgtg----tctgtgatcttgctttatacagggctctaccc
                  BlackMuntjac  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                 IndianMuntjac  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                 ReevesMuntjac  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                PereDavidsDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
               WhiteLippedDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                   YarkandDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                       RedDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatgttgctttatacagtgctctaccc
                       HogDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
               WhiteTailedDeer  c--atgacaagaaagatttttgtg-ccgtgtgtctctctctgatcttgctttatacagtgctctaccc
                      MuleDeer  c--atgacaagaaagatttttgtg-ccgtgtgtctctctctgatcttgctttatacagtgctctaccc
                      Reindeer  c--atgacaagaaagatttttgtg-ccatgtgtctctctctgatcttgctttatacagtgctctaccc
                EasternRoeDeer  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctaccc
                   EurasianElk  c--atgacaagaaagatttttgtg-ccatgtg----tctctgatcttgctttatacagtgctctactc
              ChineseWaterDeer  c--atgaaaagaaagatttttgta-ccatgtg----tctctgatcttgctttatacagtgctctacct
                       Giraffe  c--atgacaagaaagatttttgtg-ccacgtg----tctgcaatcttgctttatacagtgctctaccc
                     Pronghorn  c--atgacaagaaagatttttatg-ccatgtg----tctgtgatcttgctttatacagtgctctatcc
                        Cattle  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacaggcctctaccc
                    ZebuCattle  c--atgaccagaaagagttttgtg-ccatgtg----tctgcgatcttgctttatacagggctctaccc
              SiberianMuskDeer  t--atgacaagaaagatttttgtg-ccatgtg----tctgtgatcttgctttatacagggctctaccc
                         Okapi  c--atgacaagaaagatttttgtg-ccatgtg----tctgcgatcttgctttatacagtgctctaccc

Alignment block 29 of 177 in window, 129061128 - 129061132, 5 bps 
B D  Oar_rambouillet_v1_0_addY  acttt
                 JavaMouseDeer  acttt
                         Bongo  acttt
                         Saiga  gcttt
                         Gayal  acttt
                    LesserKudu  acttt
                     Sitatunga  acttt
                 MountainNyala  acttt
               LesserMouseDeer  acttt
                AlpineMuskDeer  acttt
                WesternRoeDeer  acttt
                          Gaur  acttt
                 AmericanBison  acttt
                       WildYak  acttt
                   DomesticYak  acttt
                  WaterBuffalo  acttt
                AfricanBuffalo  acttt
                   CommonEland  acttt
                   GreaterKudu  acttt
                      Bushbuck  acttt
                        Impala  acttt
                          Suni  acttt
                  Klipspringer  acttt
                 RoyalAntelope  acttt
                   KirksDikDik  acttt
                      Steenbok  acttt
            PrzewalskisGazelle  acttt
                         Oribi  gcttt
               ThomsonsGazelle  gcttt
                 GrantsGazelle  gcttt
                       Gerenuk  gcttt
                     Springbok  gcttt
                MaxwellsDuiker  acttt
                 HarveysDuiker  acttt
                 BohorReedbuck  acttt
              DefassaWaterbuck  acttt
                        Lechwe  acttt
                       Gemsbok  acttt
            ScimitarHornedOryx  acttt
                  RoanAntelope  acttt
                 SableAntelope  acttt
                BlueWildebeest  acttt
                          Topi  acttt
                        Herola  acttt
               TibetanAntelope  acttt
                  MountainGoat  acttt
               EuropeanMouflon  acttt
                AsiaticMouflon  acttt
                     SnowSheep  acttt
                  BighornSheep  acttt
                  BarbarySheep  acttt
                        Bharal  acttt
                   NilgiriTahr  acttt
B D                       ARS1  acttt
                      WildGoat  acttt
                  SiberianIbex  acttt
         ChineseForestMuskDeer  acttt
                  BlackMuntjac  acttt
                 IndianMuntjac  acttt
                 ReevesMuntjac  acttt
                PereDavidsDeer  acttt
               WhiteLippedDeer  acttt
                   YarkandDeer  acttt
                       RedDeer  acttt
                       HogDeer  acttt
               WhiteTailedDeer  acttt
                      MuleDeer  acttt
                      Reindeer  atttt
                EasternRoeDeer  acttt
                   EurasianElk  acttt
              ChineseWaterDeer  gcttt
                       Giraffe  actta
                     Pronghorn  acttt
                        Cattle  acttt
                    ZebuCattle  acttt
              SiberianMuskDeer  acttt
                         Okapi  acttt

Alignment block 30 of 177 in window, 129061133 - 129061402, 270 bps 
B D  Oar_rambouillet_v1_0_addY  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                 JavaMouseDeer  aaactggactc-aaacagtttcaaaatactg--tttttctta----------------t-----------
                         Bongo  aaactggactcaaaacagtttcaaaatactg-cgttttctta----------------t-----------
                         Saiga  agactggactcagaacagtttcaaaatactg--gttttctta----------------t-----------
                         Gayal  aaactggactcaaaacagtttcaaaatactg-ctttttctta----------------t-----------
                    LesserKudu  aaactggactcaaaacagtttcaaaataatg-ctttttttta----------------t-----------
                     Sitatunga  aaactggactcaaaacagtttcaaaatactg-ctttttctta----------------t-----------
                 MountainNyala  aaactggactcaaaacagtttcaaaatactg-ctttttctta----------------t-----------
               LesserMouseDeer  aaactggactc-aaacagtttcaaaatact--gtttttctta----------------t-----------
                AlpineMuskDeer  aaactggactcaaaacagtttgaaaatactg-gtttttctta----------------t-----------
                WesternRoeDeer  aaactggactcaaaacagtttcaaaatattg-gtttttcttactaggttataactaggt-----------
                          Gaur  aaactggactcaaaacagtttcaaaatactgct-ttttctta----------------t-----------
                 AmericanBison  aaactggactcaaaacagtttcaaaatactgct-ttttctta----------------t-----------
                       WildYak  aaactggactcaaaacagtttcaaaatactgct-ttttctta----------------t-----------
                   DomesticYak  aaactggactcaaaacagtttcaaaatactgct-ttttctta----------------t-----------
                  WaterBuffalo  aaactggactcaaaatagtttcaaaatactgct-ttttctta----------------t-----------
                AfricanBuffalo  aaactggactcaaaacagtttcaaaatactgct-ttttctta----------------t-----------
                   CommonEland  aaactggactcaaaacagtttcaaaatactgct-ttttttta----------------t-----------
                   GreaterKudu  aaactggactcaaaacagtttcaaaatactgct-ttttctta----------------t-----------
                      Bushbuck  aaactggactcaaaacagtttcaaaatactgct-ttttttta----------------t-----------
                        Impala  agactggactcaaaacagtttcaaaagactg-g-ttttctta----------------t-----------
                          Suni  agactggactcaaaacagtttcagaagactg-g-ttttctta----------------t-----------
                  Klipspringer  agactggactcagaacagtctcaaaatactg-g-ttttctta----------------t-----------
                 RoyalAntelope  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                   KirksDikDik  agactggactcagaacagtgtcaaagtactg-g-ttttctta----------------t-----------
                      Steenbok  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
            PrzewalskisGazelle  agactggactcagaaccgtttcaaaatactg-g-ttttctta----------------t-----------
                         Oribi  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
               ThomsonsGazelle  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                 GrantsGazelle  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                       Gerenuk  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                     Springbok  agattggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                MaxwellsDuiker  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                 HarveysDuiker  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                  CommonDuiker  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                 BohorReedbuck  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
              DefassaWaterbuck  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                        Lechwe  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                       Gemsbok  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
            ScimitarHornedOryx  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                  RoanAntelope  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                 SableAntelope  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                BlueWildebeest  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                          Topi  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                        Herola  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
               TibetanAntelope  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                  MountainGoat  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
               EuropeanMouflon  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                AsiaticMouflon  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                     SnowSheep  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                  BighornSheep  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                  BarbarySheep  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                        Bharal  agactggactcagaacagtttctaaatactg-g-ttttctta----------------t-----------
                   NilgiriTahr  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
B D                       ARS1  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                      WildGoat  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
                  SiberianIbex  agactggactcagaacagtttcaaaatactg-g-ttttctta----------------t-----------
         ChineseForestMuskDeer  aaactggactcaaaacagtttgaaaatactg-gtttttctta----------------t-----------
                  BlackMuntjac  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                 IndianMuntjac  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                 ReevesMuntjac  aaactggactcaaaacagtttcaaagtactg-gtttttctta----------------c-----------
                PereDavidsDeer  aaactggactcaaaacagtttcaaaagactg-gtttttctta----------------c-----------
               WhiteLippedDeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                   YarkandDeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                       RedDeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                       HogDeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
               WhiteTailedDeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                      MuleDeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                      Reindeer  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
                EasternRoeDeer  aaactggactcaaaacagtttcaaaatattg-gtttttctta----------------ctaggttataac
                   EurasianElk  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------c-----------
              ChineseWaterDeer  aaactggactcaaaacagtttcaaaatattg-gtttttctta----------------c-----------
                       Giraffe  aaactgggctcaaaacagtttcaagatactg-gattttctta----------------t-----------
                     Pronghorn  aaactggactcaaaacagtttcaaaatactg-gtttttctta----------------t-----------
                        Cattle  aaactggactcaaaacagtttcaaaatactg-ctttttctta----------------t-----------
                    ZebuCattle  aaactggactcaaaacagtttcaaaatactg-ctttttctta----------------t-----------
              SiberianMuskDeer  aaactggactcaaaacagtttgaaaatactg-gtttttctta----------------t-----------
                         Okapi  aaactgggctcaaaacagtttcaaaatactg-ggttttctta----------------t-----------

     Oar_rambouillet_v1_0_addY  -----taag-------taactaggttataaggcaacaaacaaatttcctttaagactgtgctatcagata
                 JavaMouseDeer  -----taag-------taattaggttataaggcaacagataattttcctttaagactgtgctatcagata
                         Bongo  -----taag-------taactaggttataaggcaataaataaatttcctttaagactatgctatcagata
                         Saiga  -----taaa-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                         Gayal  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
                    LesserKudu  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                     Sitatunga  -----taag-------taactaggttataaggcaataaataaatttcctttaagactatgctatcagatt
                 MountainNyala  -----taag-------taactaggttataaggcaataaataaatttcctttaagactatgctatcagata
               LesserMouseDeer  -----taag-------taattaggttataaggcaacagataattttcctttaagactgtgctatcagata
                AlpineMuskDeer  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                WesternRoeDeer  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                          Gaur  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
                 AmericanBison  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
                       WildYak  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
                   DomesticYak  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
                  WaterBuffalo  -----taag-------taactaggttataaggcaacaaataagtttcctttaagactgtgctatcagata
                AfricanBuffalo  -----taag-------taactaggttataaggcaacaaataagtttcctttaagactgtgctatcagata
                   CommonEland  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                   GreaterKudu  -----taag-------taactaggttataaggcaataaataaatttcctttaagactgtgctatcagata
                      Bushbuck  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                        Impala  -----taag-------taactgggttataaggcaacaaataaatttcctttaagactatgctatcagata
                          Suni  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                  Klipspringer  -----taag-------taactaggttataaggcaaggaataaattttccttaagactgtgctctcagata
                 RoyalAntelope  -----gaag-------taactaggttataaggcaacaaataaattttttttaagactgtgctatcagata
                   KirksDikDik  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                      Steenbok  -----taag-------taactaggttgtaaggcaacaaataaatttcctttaagactgtgctatcagata
            PrzewalskisGazelle  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                         Oribi  -----taag-------taactaggttacaaggcaacaaataaatttcctttaagactgtgctatcagata
               ThomsonsGazelle  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                 GrantsGazelle  -----taag-------taactaggttataaggcaacaaataaatttcctttaagaccgtgctatcagata
                       Gerenuk  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                     Springbok  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                MaxwellsDuiker  -----taag-------taactagattataaggcaacaaataaatttcctttaagactgtgctatcagata
                 HarveysDuiker  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                  CommonDuiker  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                 BohorReedbuck  -----taag-------tgactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
              DefassaWaterbuck  -----taag-------tgactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                        Lechwe  -----taag-------tgactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                       Gemsbok  -----caag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctctcagata
            ScimitarHornedOryx  -----caag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctctcagata
                  RoanAntelope  -----caag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctctcagata
                 SableAntelope  -----caagctgatcttatctaggttataaggcaacaaataaatttcctttaagactgtgctctcagata
                BlueWildebeest  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                          Topi  -----taag-------taaataggttataaggcaacaaataaatttccttgaagactgtgctattagata
                        Herola  -----taag-------taaataggttataaggcaacaaataaatttcctttaagactgtgctattagata
               TibetanAntelope  -----taag-------taactaggttataaggcaataaataaatttcctttaagactgtgctatcagata
                  MountainGoat  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
               EuropeanMouflon  -----taag-------taactaggttataaggcaacaaacaaatttcctttaagactgtgctatcagata
                AsiaticMouflon  -----taag-------taactaggttataaggcaacaaacaaatttcctttaagactgtgctatcagata
                     SnowSheep  -----taag-------taactaggttataaggcaacaaacaaatttcctttaagactgtgctatcagata
                  BighornSheep  -----taag-------taactaggttataaggcaacaaacaaatttcctttaagactgtgctatcagata
                  BarbarySheep  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                        Bharal  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                   NilgiriTahr  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                          ARS1  -----ttag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                      WildGoat  -----ttag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                  SiberianIbex  -----ttag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
         ChineseForestMuskDeer  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                  BlackMuntjac  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                 IndianMuntjac  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                 ReevesMuntjac  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                PereDavidsDeer  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
               WhiteLippedDeer  -----taag-------taactaggttataaggcaacaaatagatttccttt-ggactgtgctatcggata
                   YarkandDeer  -----taag-------taactaggttataaggcaacaaatagatttccttt-ggactgtgctatcggata
                       RedDeer  -----taag-------taactaggttataaggcaacaaatagatttccttt-ggactgtgctatcggata
                       HogDeer  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
               WhiteTailedDeer  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                      MuleDeer  -----taac-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                      Reindeer  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                EasternRoeDeer  taggttaag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                   EurasianElk  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
              ChineseWaterDeer  -----taag-------taactaggttataaggcaacaaatagatttcctttaggactgtgctatcagata
                       Giraffe  -----taag-------taactaggttataaggcaacaaatgaatttcctttaagactgtgctatcagata
                     Pronghorn  -----taag-------taactaggttatcaggcaacaaataaatttcctttaagactgcgctctcagata
                        Cattle  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
                    ZebuCattle  -----taag-------taactagtttataaggcaacaaataaatttcctttaagactgtgctatcagata
              SiberianMuskDeer  -----taag-------taactaggttataaggcaacaaataaatttcctttaagactgtgctatcagata
                         Okapi  -----taag-------taactaggttataaggcaacaaatgaatttcctttaagactgtgctatcagata

     Oar_rambouillet_v1_0_addY  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                 JavaMouseDeer  atcctggtatagatttgcctgatgtataaataatcttgggaaaacaaaaaggcaagaaactgctaagtgc
                         Bongo  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                         Saiga  attctggaatagatttgccttctttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                         Gayal  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                    LesserKudu  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                     Sitatunga  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                 MountainNyala  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
               LesserMouseDeer  atcctggtatagatttgcctgatttataaataatcttgggaaaacaaaaaggcaagaaactgctaagtgc
                AlpineMuskDeer  atcctggaatagatttgcctcatttataaacaatcttgagaaaacaaaatggcaagaaattgctaagtgc
                WesternRoeDeer  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                          Gaur  atcctggaatagatttgccttacttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                 AmericanBison  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                       WildYak  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                   DomesticYak  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  WaterBuffalo  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                AfricanBuffalo  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                   CommonEland  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                   GreaterKudu  atcctggaatagatttgccttatttataaacaatcttgaggaaacaaaaaggcaagaaattgctaagtgc
                      Bushbuck  atcctggaataaatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                        Impala  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                          Suni  atcctggaatagatctgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  Klipspringer  atcctgggatagatctgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                 RoyalAntelope  atcctgggatagatttgccttatttataaacaatcttgaggaaacaaaaaggcaagaaattgctaagtgc
                   KirksDikDik  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                      Steenbok  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
            PrzewalskisGazelle  attctggaagagatttgccttatgtataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                         Oribi  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
               ThomsonsGazelle  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                 GrantsGazelle  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                       Gerenuk  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                     Springbok  attctggaatagatttgccttatttataaacaatcttgagaaaacaaaaatgcaagaaattgctaagtgc
                MaxwellsDuiker  atcctggaatagatttgccttatttataaaccatcttgagaaaacaaaaa-gcaagaaattgctaagtgc
                 HarveysDuiker  atcctggaatagatttgccttatttataaaccatcttgagaaaacaaaaa-gcaagaaattgctaagtac
                  CommonDuiker  atcctggaatagatttgccttatttataaaccatcttgagaaaacaaaaa-gcaagaaattgctaagtgc
                 BohorReedbuck  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
              DefassaWaterbuck  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                        Lechwe  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                       Gemsbok  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
            ScimitarHornedOryx  atcctggaatagctttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  RoanAntelope  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                 SableAntelope  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                BlueWildebeest  atcctggaatagagttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                          Topi  atcctggaatagagttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                        Herola  atcctggaatagagttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
               TibetanAntelope  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  MountainGoat  atcctgggatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
               EuropeanMouflon  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                AsiaticMouflon  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                     SnowSheep  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  BighornSheep  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  BarbarySheep  atcctggaatagatttgcctcattgataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                        Bharal  atcctggaatagatctgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                   NilgiriTahr  atcctggaatagatttgccttatttataaacaatcttgagaaattaaaaaggcaagaaattgctaagtgc
                          ARS1  atccaggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                      WildGoat  atccaggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                  SiberianIbex  atccaggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
         ChineseForestMuskDeer  atcctggaatagatttgcctcatttataaacaatcttgagaaaacaaaatggcaagaaattgctaagtgc
                  BlackMuntjac  atcctggaatagatttgccttatttatacacaatcttgagaaaacaaaaaggcaaggaattgctaagtgc
                 IndianMuntjac  atcctggaatagatttgccttatttatacacaatcttgagaaaacaaaaaggcaaggaattgctaagtgc
                 ReevesMuntjac  atcctggaatagatttgccttatttatacacaatcttgagaaaacaaaaaggcaaggaattgctaagtgc
                PereDavidsDeer  atcctgggatagatttgccttatttataaaccatcttgagaaaacaaaaaggcaagaaattgctaagtgc
               WhiteLippedDeer  atcctgggatagatttgccttatttataaaccatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                   YarkandDeer  atcctgggatagatttgccttatttataaaccatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                       RedDeer  atcctgggatagatttgccttatttataaaccatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                       HogDeer  atcctgggatagatttgccttatttataaaccatcttgagaaaacaaaaaggcaagaaattgctaagtgc
               WhiteTailedDeer  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                      MuleDeer  atcctggaatagatgtgccttatttataaacaatcttgagaaaacaaaaaggcaagaaatggctaagtgc
                      Reindeer  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                EasternRoeDeer  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                   EurasianElk  atcctggaatagacttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
              ChineseWaterDeer  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                       Giraffe  atcctggaatagatttgccttatttataaacgatcttgagagaacaaaaaggcaagaaattgctaagtgc
                     Pronghorn  atcctggaatagatttgccttatttgtaaacaatcttgagaagacaaaaagacaagaaattgctaagagc
                        Cattle  atcctggaatagatttgccttacttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc
                    ZebuCattle  atcctggaatagatttgccttatttataaacaatcttgagaaaacaaataggcaagaaattgctaagtgc
              SiberianMuskDeer  atcctggaatagatttgcctcatttataaacaatcttgagaaaacaaaatggcaagaaattgctaagtgc
                         Okapi  atcctggaatagatctgccttatttataaacaatcttgagaaaacaaaaaggcaagaaattgctaagtgc

     Oar_rambouillet_v1_0_addY  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                 JavaMouseDeer  ttctacttacaatgacagcctggccctaaagacaatgttttttcggttttgaaatagtttgaatataaca
                         Bongo  ttctgcttacaatgacagcctggctctaaagacaatgttttctaaattttgaaacagcttgaatacaaca
                         Saiga  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                         Gayal  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                    LesserKudu  ttctgcttacaatgacagcctggctctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                     Sitatunga  ttctgcttacaatgacagcctggctctaaagacaatgttttctaaattttgaaacagcttgaatacaaca
                 MountainNyala  ttctgcttacaatgacagcctggctctaaagacaatgttttctaaattttgaaacagcttgaatacaaca
               LesserMouseDeer  ttctacttacaatgacagcctggccctaaagacaatgttttttcggttttgaaatagtttgaatataaca
                AlpineMuskDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttttaaacagcttgaacacaaca
                WesternRoeDeer  ttatgcttac-atgacagcctggccctaaagacaatgttttgtaagttttgaaatagcttgaatacaaca
                          Gaur  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                 AmericanBison  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                       WildYak  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                   DomesticYak  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                  WaterBuffalo  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                AfricanBuffalo  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                   CommonEland  ttctgcttacaatgacagcctggctctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                   GreaterKudu  ttctgcttacaatgacagcctggctctaaagacaatgttttctaagttttgaaacagcttgaaaacaaca
                      Bushbuck  ttctgcttacaatgacagcctggctctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                        Impala  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacggcttgaatataaca
                          Suni  ttctgcttaccatgacagcctgtccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                  Klipspringer  ttctgcttacagtgagagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                 RoyalAntelope  ttctgcttacaatgacagcctggccctaaagacaatgttttct--gtttggaaacagcttgaatacaaca
                   KirksDikDik  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgcatacaaca
                      Steenbok  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttagaaacagcttgaatacaaca
            PrzewalskisGazelle  ttctgcttacaatgacagcctggccctaaagacagtgttttctaagtttggaaacagcttgaatacaaca
                         Oribi  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
               ThomsonsGazelle  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                 GrantsGazelle  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                       Gerenuk  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                     Springbok  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                MaxwellsDuiker  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                 HarveysDuiker  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaatacaaca
                  CommonDuiker  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttggaaacagcttgaacacaaca
                 BohorReedbuck  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
              DefassaWaterbuck  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                        Lechwe  ttctgcttacaatgacagcctggccctgaagacaatgttttctaagttttgaaacagcttgaatacaaca
                       Gemsbok  ttctgcttacaatgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
            ScimitarHornedOryx  ttctgcttacaatgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                  RoanAntelope  ttctgcttacaatgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                 SableAntelope  ttctgcttacaatgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                BlueWildebeest  ttctgcttacagtgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                          Topi  ttctgcttacaatgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                        Herola  ttctgcttacaatgacagtctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
               TibetanAntelope  ttctgcttacaatgacagtctgaccctaaagacaatgttttctaggttttgaaacagcttgaatacaaca
                  MountainGoat  ttctgcttacaatgacagtctgaccctaaagacaatgttttctaggttttgaaacagcttgaatacaaca
               EuropeanMouflon  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                AsiaticMouflon  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                     SnowSheep  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                  BighornSheep  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                  BarbarySheep  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                        Bharal  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaacg
                   NilgiriTahr  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                          ARS1  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                      WildGoat  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
                  SiberianIbex  ttctgcttacaatgacagtctgaccctaaagacagtgttttctaggttttgaaacagcttgaatacaaca
         ChineseForestMuskDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttttaaacagcttgaacacaaca
                  BlackMuntjac  ttctgcttccaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                 IndianMuntjac  ttctgcttacaatgacagcctggccctaaagacagtgttttctaagttttgaaatagcttgaatacaaca
                 ReevesMuntjac  ttctgcttacaatgacagcctggccctaaagacagtgttttctaagttttgaaatagcttgaatacaaca
                PereDavidsDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
               WhiteLippedDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                   YarkandDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                       RedDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                       HogDeer  ttctgcttacaatgacagcctggctctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
               WhiteTailedDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagtttgaatacaaca
                      MuleDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttcaaatagtttgaatacaaca
                      Reindeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagtttgaatacaaca
                EasternRoeDeer  ttatgcttac-atgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                   EurasianElk  ttctgcttacaatgacagcctggccctaaagacagtgttttctaagttttgaaatagcttgaatacaaca
              ChineseWaterDeer  ttctgcttac-ttgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                       Giraffe  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                     Pronghorn  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca
                        Cattle  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
                    ZebuCattle  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaacagcttgaatacaaca
              SiberianMuskDeer  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagtttttaaacagcttgaacacaaca
                         Okapi  ttctgcttacaatgacagcctggccctaaagacaatgttttctaagttttgaaatagcttgaatacaaca

     Oar_rambouillet_v1_0_addY  tcgaaattttggtgccaattacctg--ctag------tt
                 JavaMouseDeer  tctaaattttggtgctaattaccaggttttg------tt
                         Bongo  tctaagtttcggtgctaattacctg--ctag----tttt
                         Saiga  tctaaattttggtgctaattacctg--ctag-------t
                         Gayal  tctaagttttggtgctaattacctg--ctag------tt
                    LesserKudu  tctaagttttggtgctaattacctg--ctaggttttttt
                     Sitatunga  tctaagtttcggtgctaattacctg--ctag------tt
                 MountainNyala  tctaagtttcggtgctaattacctg--ctag------tt
               LesserMouseDeer  tctaaattttggtgctaattaccag--gttt------tt
                AlpineMuskDeer  tctaaattttggtgctaattacctg--ctag------tt
                WesternRoeDeer  tctaaattttggtgctaattacctg--ctag------tt
                          Gaur  tctaagttttggtgctaattacctg--ctag------tt
                 AmericanBison  tctaagttttggtgctaattacctg--ctag------tt
                       WildYak  tctaagttttggtgctaattacctg--ctag------tt
                   DomesticYak  tctaagttttggtgctaattacctg--ctag------tt
                  WaterBuffalo  tctaagttttggtgctaattacctg--ctag------tg
                AfricanBuffalo  tctaagttttggtgctaattacctg--ctag------tt
                   CommonEland  tctaagttttggtgctaattacctg--ctag--tttttt
                   GreaterKudu  tctaagttttggtgctaattacctg--ctag------tt
                      Bushbuck  tctaagttttggtgctaattacctg--ctag-----ttt
                        Impala  tctaaattttggtgctaattacctg--ctag-----ttt
                          Suni  tctaaattttggtgctaattacctg--ctag------tt
                  Klipspringer  tctaaattttggtgctaattacctg--ctag-------t
                 RoyalAntelope  tctaaattttggtgctaattacctg--ctag------tt
                   KirksDikDik  tctaaattttggtgctaattacctg--ctag------tt
                      Steenbok  tctaaattttggtgataattacctg--ctag------tt
            PrzewalskisGazelle  tctaaattttggtgctaattacctg--ctag------tt
                         Oribi  tctaaattttggtgctaattaactg--ctag------tt
               ThomsonsGazelle  tctaaattttggtgctaattacctg--ctag------tt
                 GrantsGazelle  tctaaattttggtgctaattacctg--ctag------tt
                       Gerenuk  tctaaattttggtgctaattacctg--ctag------tt
                     Springbok  tctaaattttggtgctaattacctg--ctag------tt
                MaxwellsDuiker  tctaaattttggtgccaattacctg--ctag------tt
                 HarveysDuiker  tctaaattttggtgccaattacctg--ctag-------t
                  CommonDuiker  tctaaattttggtgccaattacctg--ctag------tt
                 BohorReedbuck  tctaaattttggtgctaattacctg--ctag------tt
              DefassaWaterbuck  tctaaattttggtgctaattacctg--ctag------tt
                        Lechwe  tctaaattttggtgctaattacctg--ctag------tt
                       Gemsbok  tctaaattttggtgctaattacctg--ctag------tt
            ScimitarHornedOryx  tctaaattttggtgctaattacctg--ctag------tt
                  RoanAntelope  tctaaattttggtgctaattacctg--ctag------tt
                 SableAntelope  tctaaattttggtgctaattacctg--ctag------tt
                BlueWildebeest  tctaaattttggtgctaattacc-a--ctag------tt
                          Topi  tctaaattttggtgctaattacc-a--ctag------tt
                        Herola  tctaaattttggtgctaattacc-a--ctag------tt
               TibetanAntelope  tctaaattttggtgccaattacctg--ctag------tt
                  MountainGoat  cctaaattttggtgccaattacccg--ctag------tt
               EuropeanMouflon  tcgaaattttggtgccaattacctg--ctag------tt
                AsiaticMouflon  tcgaaattttggtgccaattacctg--ctag------tt
                     SnowSheep  tcgaaattttggtgccaattacctg--ctag------tt
                  BighornSheep  tcgaaattttggtgccaattacctg--ctag------tt
                  BarbarySheep  tctaaattttggtgccaattacctg--ctag------tt
                        Bharal  tctaaattttggtgccaattacctg--ctag------tt
                   NilgiriTahr  tcgaaattttggtgccaattacctg--ctag------tt
                          ARS1  tctaaattttggtgccaattacctg--ctag------tt
                      WildGoat  tctaaattttggtgccaattacctg--ctag------tt
                  SiberianIbex  tctaaattttggtgccaattacctg--ctag------tt
         ChineseForestMuskDeer  tctaaattttggtgctaattacctg--ctag------tt
                  BlackMuntjac  tctaaattttggtgctaattacctg--ctag------tt
                 IndianMuntjac  tctaaattttggtgctaattacctg--ctag------tt
                 ReevesMuntjac  tctaaattttggtgctaattacctg--ctag------tt
                PereDavidsDeer  tctaaattttggtgctaattacctg--ctag------tt
               WhiteLippedDeer  tctaaattttggtgctaattacctg--ctag------tt
                   YarkandDeer  tctaaattttggtgctaattacctg--ctag------tt
                       RedDeer  tctaaattttggtgctaattacctg--ctag------tt
                       HogDeer  tctaaattttggtgctaattacctg--ctag------tt
               WhiteTailedDeer  tctaaattttggtgctaattacctg--ctag------tt
                      MuleDeer  tctaaattttggtgctaattacctg--ctag------tt
                      Reindeer  tctaaattttggtgctaattacctg--ctag--------
                EasternRoeDeer  tctaaattttggtgctaattacctg--ctag------tt
                   EurasianElk  tctaaattttggtgctaattacctg--ctag------tt
              ChineseWaterDeer  tctaaattttggtgctaattacctg--ctag------tt
                       Giraffe  tctgaattttggtgctaattacctg--ctag------tt
                     Pronghorn  tctaaattttggtgctaattacctg--ctag------tt
                        Cattle  tctaagttttggtgctaattacctg--ctag------tt
                    ZebuCattle  tctaagttttggtgctaattacctg--ctag------tt
              SiberianMuskDeer  tctaaattttggtgctaattacctg--ctag------tt
                         Okapi  tctgaattttggtgctaattacctg--ctag------tt

Alignment block 31 of 177 in window, 129061403 - 129061403, 1 bps 
B D  Oar_rambouillet_v1_0_addY  t
                 JavaMouseDeer  t
                         Bongo  t
                         Saiga  t
                         Gayal  t
                    LesserKudu  t
                     Sitatunga  t
                 MountainNyala  t
               LesserMouseDeer  t
                AlpineMuskDeer  t
                WesternRoeDeer  t
                          Gaur  t
                 AmericanBison  t
                       WildYak  t
                   DomesticYak  t
                  WaterBuffalo  t
                AfricanBuffalo  t
                   CommonEland  t
                   GreaterKudu  t
                      Bushbuck  t
                        Impala  t
                          Suni  t
                  Klipspringer  t
                 RoyalAntelope  t
                   KirksDikDik  t
                      Steenbok  t
            PrzewalskisGazelle  t
                         Oribi  t
               ThomsonsGazelle  t
                 GrantsGazelle  t
                       Gerenuk  t
                     Springbok  a
                MaxwellsDuiker  t
                 HarveysDuiker  t
                  CommonDuiker  t
                 BohorReedbuck  t
              DefassaWaterbuck  t
                        Lechwe  t
                       Gemsbok  t
            ScimitarHornedOryx  t
                  RoanAntelope  t
                 SableAntelope  t
                BlueWildebeest  t
                          Topi  t
                        Herola  t
               TibetanAntelope  t
                  MountainGoat  t
               EuropeanMouflon  t
                AsiaticMouflon  t
                     SnowSheep  t
                  BighornSheep  t
                  BarbarySheep  t
                        Bharal  t
                   NilgiriTahr  t
B D                       ARS1  t
                      WildGoat  t
                  SiberianIbex  t
         ChineseForestMuskDeer  t
                  BlackMuntjac  t
                 IndianMuntjac  t
                 ReevesMuntjac  t
               WhiteLippedDeer  t
                   YarkandDeer  t
                       RedDeer  t
               WhiteTailedDeer  t
                      MuleDeer  t
                      Reindeer  t
                EasternRoeDeer  t
                   EurasianElk  t
              ChineseWaterDeer  t
                       Giraffe  t
                     Pronghorn  t
                        Cattle  t
                    ZebuCattle  t
              SiberianMuskDeer  t
                         Okapi  t

Alignment block 32 of 177 in window, 129061404 - 129061405, 2 bps 
B D  Oar_rambouillet_v1_0_addY  tt
                 JavaMouseDeer  tt
                         Bongo  tt
                         Saiga  tt
                         Gayal  tt
                    LesserKudu  tt
                     Sitatunga  tt
                 MountainNyala  tt
               LesserMouseDeer  tt
                AlpineMuskDeer  tt
                WesternRoeDeer  tt
                          Gaur  tt
                 AmericanBison  tt
                       WildYak  tt
                   DomesticYak  tt
                  WaterBuffalo  tt
                AfricanBuffalo  tt
                   CommonEland  tt
                   GreaterKudu  tt
                      Bushbuck  tt
                        Impala  tt
                          Suni  tt
                  Klipspringer  tt
                 RoyalAntelope  tt
                   KirksDikDik  tt
                      Steenbok  tt
            PrzewalskisGazelle  tt
                         Oribi  tt
               ThomsonsGazelle  tt
                 GrantsGazelle  tt
                       Gerenuk  tt
                     Springbok  aa
                MaxwellsDuiker  tt
                 HarveysDuiker  tt
                  CommonDuiker  tt
                 BohorReedbuck  tt
              DefassaWaterbuck  tt
                        Lechwe  tt
                       Gemsbok  tt
            ScimitarHornedOryx  tt
                  RoanAntelope  tt
                 SableAntelope  tt
                BlueWildebeest  tt
                          Topi  tt
                        Herola  tt
               TibetanAntelope  tt
                  MountainGoat  tt
               EuropeanMouflon  tt
                AsiaticMouflon  tt
                     SnowSheep  tt
                  BighornSheep  tt
                  BarbarySheep  tt
                        Bharal  tt
                   NilgiriTahr  tt
B D                       ARS1  tt
                      WildGoat  tt
                  SiberianIbex  tt
         ChineseForestMuskDeer  tt
                  BlackMuntjac  tt
              SiberianMuskDeer  tt
                         Okapi  tt

Alignment block 33 of 177 in window, 129061406 - 129061408, 3 bps 
B D  Oar_rambouillet_v1_0_addY  ---aa--a
                         Bongo  t--t----
                         Saiga  c--a----
                         Gayal  t--t----
                    LesserKudu  t--t----
                     Sitatunga  tttt----
               LesserMouseDeer  ---t----
                AlpineMuskDeer  ---t----
                          Gaur  ---tt--a
                 AmericanBison  ---tt--a
                       WildYak  ---tt--a
                   DomesticYak  ---tt--a
                  WaterBuffalo  ---tt--a
                AfricanBuffalo  ---tt--a
                   CommonEland  ---tttaa
                   GreaterKudu  ---tttaa
                      Bushbuck  ---tt--t
                        Impala  ---ta--t
                          Suni  ---tt--t
                  Klipspringer  ---ta--c
                 RoyalAntelope  ---aa--a
                   KirksDikDik  ---aa--a
                      Steenbok  ---aa--a
            PrzewalskisGazelle  ---aa--a
                         Oribi  ---aa--a
               ThomsonsGazelle  ---aa--a
                 GrantsGazelle  ---aa--a
                       Gerenuk  ---aa--a
                     Springbok  ---aa--a
                MaxwellsDuiker  ---ta--a
                 HarveysDuiker  ---ta--a
                  CommonDuiker  ---ta--a
                 BohorReedbuck  ---aa--a
              DefassaWaterbuck  ---aa--a
                        Lechwe  ---aa--a
                       Gemsbok  ---aa--a
            ScimitarHornedOryx  ---aa--a
                  RoanAntelope  ---aa--a
                 SableAntelope  ---aa--a
                BlueWildebeest  ---aa--a
                          Topi  ---aa--a
                        Herola  ---aa--a
               TibetanAntelope  ---aa--t
                  MountainGoat  ---aa--a
               EuropeanMouflon  ---aa--a
                AsiaticMouflon  ---aa--a
                     SnowSheep  ---aa--a
                  BighornSheep  ---aa--a
                  BarbarySheep  ---aa--a
                        Bharal  ---aa--a
                   NilgiriTahr  ---aa--a
B D                       ARS1  ---aa--a
                      WildGoat  ---aa--a
                  SiberianIbex  ---aa--a
              SiberianMuskDeer  ---t----

Alignment block 34 of 177 in window, 129061409 - 129061415, 7 bps 
B D  Oar_rambouillet_v1_0_addY  tt-tt-tt---t
                 JavaMouseDeer  tt-tt-tt---t
                         Bongo  at-tt-tt---t
                         Saiga  aa-tt-tt---t
                         Gayal  at-tt-tt---t
                    LesserKudu  at-tt-tt---t
                     Sitatunga  at-tt-tt---t
               LesserMouseDeer  tt-tt-tt---t
                AlpineMuskDeer  ta-tt-tt---t
                WesternRoeDeer  ---tt-tt---t
                          Gaur  -t-tt-tt---t
                 AmericanBison  -t-tt-tt---t
                       WildYak  -t-tt-tt---t
                   DomesticYak  -t-tt-tt---t
                  WaterBuffalo  -t-tt-tt---t
                AfricanBuffalo  -t-tt-tt---t
                   CommonEland  -t-tt-tt---t
                   GreaterKudu  -t-tt-tt---t
                      Bushbuck  at-tt-tt---t
                        Impala  tt-tt-tt---t
                          Suni  tt-tt-tt---t
                  Klipspringer  tt-tt-tt---t
                 RoyalAntelope  tt-tt-tt---t
                   KirksDikDik  tt-tt-tt---t
                      Steenbok  tt-tt-tt---t
            PrzewalskisGazelle  tt-tt-tt---t
                         Oribi  tt-tt-tt---t
               ThomsonsGazelle  gt-tt-tt---c
                 GrantsGazelle  tt-tt-tt---t
                       Gerenuk  tt-tt-tt---t
                     Springbok  tt-tt-tt---t
                MaxwellsDuiker  tt-tt-tt---t
                 HarveysDuiker  tt-tt-tt---t
                  CommonDuiker  tt-tt-tt---t
                 BohorReedbuck  tt-tt-tt---t
              DefassaWaterbuck  tt-tt-tt---t
                        Lechwe  tt-tt-tt---t
                       Gemsbok  tt-tt-tt---t
            ScimitarHornedOryx  tt-tt-tt---t
                  RoanAntelope  tt-tt-tt---t
                 SableAntelope  tt-tt-tt---t
                BlueWildebeest  tt-tt-tt---t
                          Topi  tt-tt-tt---t
                        Herola  tt-tt-tt---t
               TibetanAntelope  tt-tt-tt---t
                  MountainGoat  tt-tt-tt---t
               EuropeanMouflon  tt-tt-tt---t
                AsiaticMouflon  tt-tt-tt---t
                     SnowSheep  tt-tt-tt---t
                  BighornSheep  tt-tt-tt---t
                  BarbarySheep  tt-tt-tt---t
                        Bharal  tt-tt-tt---t
                   NilgiriTahr  tt-tt-tt---t
B D                       ARS1  tt-tt-tt---t
                      WildGoat  tt-tt-tt---t
                  SiberianIbex  tt-tt-tt---t
         ChineseForestMuskDeer  ttatt-tt---t
                  BlackMuntjac  tt-tt-cc---c
                 IndianMuntjac  ---tt-tc---c
                 ReevesMuntjac  ---tt-tc---c
               WhiteTailedDeer  tt-tt-tt---t
                      MuleDeer  tt-tt-tt---t
                      Reindeer  tt-tt-tt---t
                EasternRoeDeer  tt-tt-tt---t
                   EurasianElk  tt-tt-tt---t
              ChineseWaterDeer  tt-tt-tt---t
                       Giraffe  tt-tt-tt---t
                     Pronghorn  tt-ttatttcct
                        Cattle  tt-ttatt---t
                    ZebuCattle  tt-ttatt---t
              SiberianMuskDeer  ta-tt-tt---t
                         Okapi  ---tt-tt---t

Alignment block 35 of 177 in window, 129061410 - 129061492, 83 bps 
B D  Oar_rambouillet_v1_0_addY  tttttttcctt--------------------------t-aaaaggctgtcccagcgccctaacataacag
                        Rabbit  ttttgtttctt--------------------------t-aaaaggatattcctgagccaaaacctcccgg
                         Horse  ctttgttcctt--------------------------t-aaaaggctattccaaagccaaaacataacag
               ChinesePangolin  ttttgtttctt--------------------------t-aaaagtctattccagagctaaaacataacag
                         Human  ttttgctcctt--------------------------t-aaaaggttattccaaagccaaaatgtaacag
                      Aardvark  ttctgtgcttt--------------------------t-aaaagactgttccagagccaaagcataacag
                     BlueWhale  ttttgttcctt--------------------------t-aaaaggctatcccagcacccaaacataacag
       CommonBottlenoseDolphin  ttttgttcctt--------------------------t-aaaaggctatcccagcacccaaacataacag
                   BelugaWhale  ttttgttcctt--------------------------t-aaaaggctatcccagcacccaaacataacag
                           Pig  tttggttcctt--------------------------taaaaaagctatcccag-gccaaaacataacag
                FloridaManatee  ttctatacttt--------------------------t-agaaaactatgccagagacaaagcacagtag
           GreaterHorseshoeBat  ttttgttcctt--------------------------t-aaaaggctattccagcgtcaaaatgtaacag
       WesternEuropeanHedgehog  actcattccttagagagagagagaaagaaagaaagaaa-gaaaggcaatcccagagtcaaacag-aacag
                    HouseMouse  tgttgttcctt--------------------------g-gaatagctcttccagagcccaagtgtcacag
              ChineseTreeShrew  ttttgttcctg--------------------------t-aaattgtgaatccagagccaaaacctaacag
                        Alpaca  ttttgttcctt--------------------------t-aaaaggctatcccagcgccaaagcacagcag
             WildBactrianCamel  ttttgttcctt--------------------------t-aaaaggctatcccagcgccaaagcacaacag
                  ArabianCamel  ttttgttcctt--------------------------t-caaaggctatcccagcgccaaagcacaacag
                    MinkeWhale  ttttgttcctt--------------------------t-aaaaggctatcccagcacccaaacataacag
                   KillerWhale  ttttgttcctt--------------------------t-aaaaggctatcccagcacccaaacataacag
                    SpermWhale  ttttgttcctt--------------------------t-aaaaggctatcccagcacccaaacataacag
                ChacoanPeccary  ttttgttcctt--------------------------taaaaaagctatcccagtgccaaaacataacag

     Oar_rambouillet_v1_0_addY  atgcactatattttctactaattcccgaggctcagttagt
                        Rabbit  aaatactatattttctactgtttcctaaggctcagtaagt
                         Horse  atgtactatattttctcttaattcccgaggctcagttagt
               ChinesePangolin  atgtactatattttc---taattcccaaggctcagttatt
                         Human  atgtactgtgttttctactaattcctgaggctcagtaagt
                      Aardvark  atgtgctgtattttccactaattcccaagacccagtaagt
                     BlueWhale  atgtactatattttctactaattcctgaggctc----agt
       CommonBottlenoseDolphin  atgtactatattttctactaattcctgaggctc----agt
                   BelugaWhale  atgtactatattttctactaattcctgaggctc----agt
                           Pig  atgtactatattttctactaattcccgaggctcagttagt
                FloridaManatee  atgtactatattttctactaattcccgaggctcagtaagt
           GreaterHorseshoeBat  atgtactatattttctactaattcccgaggctcagttaac
       WesternEuropeanHedgehog  atgtgctatattttcttacaattcacgggtctcagctagt
                    HouseMouse  atgtattatattgtttgcc-atttctgaggttggttaaat
              ChineseTreeShrew  atgtactatattttctactaatttccaaggctcggtaggt
                        Alpaca  atgtactatattttctactaattcccg----tt----agt
             WildBactrianCamel  atgtactatattttctactaattcccg----tt----agt
                  ArabianCamel  atgtactatattttctactaattcccg----tt----agt
                    MinkeWhale  atgtactatattttctactaattcctgaggctc----agt
                   KillerWhale  atgtactatattttctactaattcctgaggctc----agt
                    SpermWhale  atgtactatattttctactaattcctgaggctc----agt
                ChacoanPeccary  atgtactatattttctactaattcccgaggctcagttagt

Alignment block 36 of 177 in window, 129061416 - 129061417, 2 bps 
B D  Oar_rambouillet_v1_0_addY  tc
                 JavaMouseDeer  tc
                         Bongo  tc
                         Saiga  t-
                         Gayal  tc
                    LesserKudu  tc
                     Sitatunga  tc
               LesserMouseDeer  tc
                AlpineMuskDeer  tc
                WesternRoeDeer  tc
                          Gaur  tc
                 AmericanBison  tc
                       WildYak  tc
                   DomesticYak  tc
                  WaterBuffalo  tc
                AfricanBuffalo  tc
                   CommonEland  tc
                   GreaterKudu  tc
                      Bushbuck  tc
                        Impala  tc
                          Suni  tt
                  Klipspringer  tc
                 RoyalAntelope  tc
                   KirksDikDik  tc
                      Steenbok  tc
            PrzewalskisGazelle  tc
                         Oribi  tc
               ThomsonsGazelle  tc
                 GrantsGazelle  tc
                       Gerenuk  tc
                     Springbok  tc
                MaxwellsDuiker  cc
                 HarveysDuiker  tc
                  CommonDuiker  tc
                 BohorReedbuck  tc
              DefassaWaterbuck  tc
                        Lechwe  tc
                       Gemsbok  tc
            ScimitarHornedOryx  tc
                  RoanAntelope  tc
                 SableAntelope  tc
                BlueWildebeest  tc
                          Topi  tc
                        Herola  tc
               TibetanAntelope  tc
                  MountainGoat  tc
               EuropeanMouflon  tc
                AsiaticMouflon  tc
                     SnowSheep  tc
                  BighornSheep  tc
                  BarbarySheep  tc
                        Bharal  tc
                   NilgiriTahr  tc
B D                       ARS1  tc
                      WildGoat  tc
                  SiberianIbex  tc
         ChineseForestMuskDeer  tc
                  BlackMuntjac  cc
                 IndianMuntjac  cc
                 ReevesMuntjac  ct
                       HogDeer  tc
               WhiteTailedDeer  cc
                      MuleDeer  -t
                      Reindeer  -t
                   EurasianElk  -c
                       Giraffe  -c
                     Pronghorn  -t
                        Cattle  -t
                    ZebuCattle  -t
              SiberianMuskDeer  tc
                         Okapi  cc

Alignment block 37 of 177 in window, 129061418 - 129061496, 79 bps 
B D  Oar_rambouillet_v1_0_addY  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                 JavaMouseDeer  ctttaagaggctaacccagtgcccaaacataacagatgtactatattttctactaattcccgaggctcag
                         Bongo  ctttaaaaggctgtcccagcgtcctaatataacagatgcactatattttctactaattcccgaggctcag
                         Saiga  -tttaaaaggctgtccccgtgccctaacataacagatgtactgtattttctactaattcccgaggctcag
                         Gayal  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                    LesserKudu  ctttaaaaggctatcccagtgtcctaacataacagatgcactatattttctactaattcccgaggctcag
                     Sitatunga  ctttaaaaggctgtcccagcgtcctaatataacagatgcactatattttctactaattcccgaggctcag
               LesserMouseDeer  ctttaagaggctaacccagtgcccaaacataacagatgtactatattttctactaattcccgaggctcag
                AlpineMuskDeer  ctttaaaaggctgttccagcgccctaacataacagatgtactatattttctactaattcccaaggctcag
                WesternRoeDeer  c--------------ccagcgccctagcatagcagatgcactgtattttctactaattctcga-gctcag
                          Gaur  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                 AmericanBison  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                       WildYak  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                   DomesticYak  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                  WaterBuffalo  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                AfricanBuffalo  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                   CommonEland  ctttaaaaggctgtcccagtgtcctaacataacagatgcactatattttctactaattcccgaggctcag
                   GreaterKudu  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctcctaattcccgaggctcag
                      Bushbuck  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctactaattcccgaggctcag
                        Impala  ctttaaaaggctgtcccagggccctaacataacagatgcactgtattttct-ctaattcccgaggctcag
                          Suni  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                  Klipspringer  ctttaaaaggctgtcccagcgccctaacataacagatgcactagattttctactaattcccgaggctcag
                 RoyalAntelope  ctttaaaaggctgtcccagcgccctaacacaacagatgcactatattttctactaattcccgaggctcag
                   KirksDikDik  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
                      Steenbok  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
            PrzewalskisGazelle  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
                         Oribi  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
               ThomsonsGazelle  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
                 GrantsGazelle  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
                       Gerenuk  ctttaaaaggctgtcccagtgccctaacataacagatgcactatattttctactaattcccgaggctcag
                     Springbok  ctttaaaagcctgtcccagtgccc-aacataacagatgcactatattttctactaattcccgaggctcag
                MaxwellsDuiker  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattccccaggctcag
                 HarveysDuiker  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                  CommonDuiker  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                 BohorReedbuck  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
              DefassaWaterbuck  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                        Lechwe  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                       Gemsbok  ctgtaaaaggcagtcccagcgccctaacataacagatgcactctattttctactaattcccgaggctcag
            ScimitarHornedOryx  ctgtaaaaggcagtcccagcgccctaacataacagatgcactctattttctactaattcccgaggctcag
                  RoanAntelope  ctgtaaaaggcagtcccagcgccctaacataacagatgcactctattttctactaattcccgagggccag
                 SableAntelope  ctgtaaaaggctgtcccagcgccctaacataacagatgcactctattttctactaattcccgagggccag
                BlueWildebeest  ctttaaaaggctgtcccagcaccctaacataacagatgcactatattttctactaattcccgaggctcag
                          Topi  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                        Herola  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
               TibetanAntelope  ctttaaaaggctgtcccagcgccctcacataacagatgcactatatttt---ctaattcccgaggctcag
                  MountainGoat  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
               EuropeanMouflon  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                AsiaticMouflon  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                     SnowSheep  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                  BighornSheep  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                  BarbarySheep  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
                        Bharal  ctttaaaaggctgtcccagtgccctgacataacagatgcactatattttctactaattcccgaggctcag
                   NilgiriTahr  ctttaaaaggctgtcccagcgccctaacataacagatgcactatattttctactaattcccgaggctcag
B D                       ARS1  ctttaaaaggccgtcccagtgccctaacataacagatgcactatgttttctactaattcccgaggctcag
                      WildGoat  ctttaaaaggccgtcccagcgccctgacataacagatgcgctatgttttctactaattcccgaggctcag
                  SiberianIbex  ctttaaaaggccgtcccagcgccctaacataacagatgcactatgttctctactaattcccgaggct--g
         ChineseForestMuskDeer  ctttaaaaggctgttccagcgccctaacataacagatgtactatattttctactaattcccaaggctcag
                  BlackMuntjac  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                 IndianMuntjac  ctttgaaagcctgtcccagcgccctagcgtagcagatgcactgtattttctactaattcccga-gctcag
                 ReevesMuntjac  ctttgaaagcctgtcccagcgccctagcgtagcagatgcactgtattttctactaattcccga-gctcag
                PereDavidsDeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
               WhiteLippedDeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                   YarkandDeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                       RedDeer  ctttgaaaggctgtcccagctccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                       HogDeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
               WhiteTailedDeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                      MuleDeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtatttgctactaattcccga-gctcag
                      Reindeer  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                EasternRoeDeer  -------------ccccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                   EurasianElk  ctttgaaaggctgtcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
              ChineseWaterDeer  -----------tttcccagcgccctagcatagcagatgcactgtattttctactaattcccga-gctcag
                       Giraffe  ctttaaaaggctatcccagcgccctaacataacagatgtactatgttttctactaattcccgaggctcag
                     Pronghorn  ctttaaaaggctatcgcagagccctaacataacagatgtactatattttctactaattcccgaggctcag
                        Cattle  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
                    ZebuCattle  ctttaaaaggctgtcccagcgtcctaacataacagatgcactatattttctgctaattcccgaggctcag
              SiberianMuskDeer  ctttaaaaggctgttccagcgccctaacataacagatgtactatattttctactaattcccaaggctcag
                         Okapi  ctttaaaaggctatcccagcgccctaacataacagatgtactatgttttctattaatttcggaggctcag

     Oar_rambouillet_v1_0_addY  ttagttgct
                 JavaMouseDeer  ttagttgct
                         Bongo  ttagttgcc
                         Saiga  tttgttgct
                         Gayal  ttagttgct
                    LesserKudu  ttagttgcc
                     Sitatunga  ttagttgcc
               LesserMouseDeer  ttagttgct
                AlpineMuskDeer  ttggttgct
                WesternRoeDeer  ct-cttgct
                          Gaur  ttagttgct
                 AmericanBison  ttagttgct
                       WildYak  ttagttgct
                   DomesticYak  ttagttgct
                  WaterBuffalo  ttagttgct
                AfricanBuffalo  ttagttgct
                   CommonEland  ttagttgcc
                   GreaterKudu  ttagttgcc
                      Bushbuck  ttagttgcc
                        Impala  ttggttgct
                          Suni  ttggttgct
                  Klipspringer  ttagttgct
                 RoyalAntelope  ttagttgct
                   KirksDikDik  ttagttgct
                      Steenbok  ttagctgct
            PrzewalskisGazelle  ttagttgct
                         Oribi  ttagttgct
               ThomsonsGazelle  ttagttgct
                 GrantsGazelle  ttagttgct
                       Gerenuk  ttagttgct
                     Springbok  ttagttgct
                MaxwellsDuiker  ttagttgct
                 HarveysDuiker  ttagttgct
                  CommonDuiker  ttagttgct
                 BohorReedbuck  ttagttgct
              DefassaWaterbuck  ttagttgct
                        Lechwe  ttagttgct
                       Gemsbok  ttagttgct
            ScimitarHornedOryx  ttagttgct
                  RoanAntelope  ttagttgct
                 SableAntelope  ttagttgct
                BlueWildebeest  ttagttgct
                          Topi  ttagttgct
                        Herola  ttagttgct
               TibetanAntelope  ttagttgct
                  MountainGoat  ttagttgct
               EuropeanMouflon  ttagttgct
                AsiaticMouflon  ttagttgct
                     SnowSheep  ttagttgct
                  BighornSheep  ttagttgct
                  BarbarySheep  ttagttgct
                        Bharal  ttagttgct
                   NilgiriTahr  ttagttgct
                          ARS1  ttagttgct
                      WildGoat  ttagttgct
                  SiberianIbex  ttagttgct
         ChineseForestMuskDeer  ttggttgct
                  BlackMuntjac  ct-cttgct
                 IndianMuntjac  ctc-ttgct
                 ReevesMuntjac  ctc-ttgct
                PereDavidsDeer  cccgttgct
               WhiteLippedDeer  cccgttgct
                   YarkandDeer  cccgttgct
                       RedDeer  cccgttgct
                       HogDeer  cccgttgct
               WhiteTailedDeer  ctc-ttgct
                      MuleDeer  ctc-ttgct
                      Reindeer  ctc-ttgct
                EasternRoeDeer  ctc-ttgct
                   EurasianElk  ctc-ttgct
              ChineseWaterDeer  ctc-ttgct
                       Giraffe  ctagttgct
                     Pronghorn  ttagttgct
                        Cattle  ttagttgct
                    ZebuCattle  ttagttgct
              SiberianMuskDeer  ttggttgct
                         Okapi  ctagttgct

Alignment block 38 of 177 in window, 129061493 - 129061691, 199 bps 
B D  Oar_rambouillet_v1_0_addY  tgctcactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttcctccagactgattggta
                        Rabbit  tgctcagtgcgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgatcggta
                         Horse  tcctcagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
               ChinesePangolin  tgctcagcatgtcttgtccccaggtaattcagcactgggggaagggttccttcttccagactgattggta
                         Human  tgctcagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                      Aardvark  tactcagtgtgccttgtccccaggtaattcaggcctgggggaagggttccttctgccagactgactggta
                     BlueWhale  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
       CommonBottlenoseDolphin  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                   BelugaWhale  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                           Pig  tgctcagtgtgtctcgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                FloridaManatee  tactcagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                       Tuatara  tgcacagtatgaccagtcgccaggtgattttgg-ctgggggaagggatccttc-catagactgactggtg
           GreaterHorseshoeBat  tgctcagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttctaccagactgattggta
       WesternEuropeanHedgehog  tgccctggctgtcttgtctccaggtaattcaggcctgggggaagggtttctt---ccagactgactggtg
                    HouseMouse  cgctccctgtgtcttgtctccaggtaattgaggcctgggggaagggttccttcctccagactgactggta
              ChineseTreeShrew  ttcttagtatg-cttgtccccaggtaattcaggactgggggaagggttccttcttccagactgattggta
                        Alpaca  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
             WildBactrianCamel  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                  ArabianCamel  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                    MinkeWhale  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                   KillerWhale  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                    SpermWhale  tgctca--gtgtcttgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                ChacoanPeccary  tgctcagtgtgtctcgtccccaggtaattcaggcctgggggaagggttccttcttccagactgattggta
                GreenSeaTurtle  ----cactgtgttcagcctgcaggtaatttttggctagaggaagtgtttccg-tcccagactgactggta
                           Dog  ------------------cccaggtaacccaggcctgggggaagggttccttcctccagactgatcggta

     Oar_rambouillet_v1_0_addY  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcttccacagtgtctc
                        Rabbit  cagctgctccgtcagcgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
                         Horse  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacggtgtctc
               ChinesePangolin  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcttccaccgtgtctc
                         Human  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggttgttcctccacagtgtctc
                      Aardvark  cagctgctcagtaagtggaactgctcagattcccaaagaattctaagtggatgttcctccaccgtgtctc
                     BlueWhale  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
       CommonBottlenoseDolphin  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtttctc
                   BelugaWhale  cagctgctcagtaagtgtaactactcagattcccagagaattctaagtggatgttcctccacagtttctc
                           Pig  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
                FloridaManatee  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgtccctccacggtgtcac
                       Tuatara  cagctggtcagctagtataactacacagattcccagagatttctaaagggatgttactccacaatttctt
           GreaterHorseshoeBat  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacggtgtctc
       WesternEuropeanHedgehog  cagctgctcggtgagtgtaactgctcagatt-ccaaaggattctaagtggatgttcctccacggtgtctc
                    HouseMouse  cagctgctcagtgagtgtaactgctcagattcccaaagaattctaagtggacgttccggcacgctgtctc
              ChineseTreeShrew  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
                        Alpaca  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
             WildBactrianCamel  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacggtgtctc
                  ArabianCamel  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacggtgtctc
                    MinkeWhale  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
                   KillerWhale  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtttctc
                    SpermWhale  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtttctc
                ChacoanPeccary  cagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatgttcctccacagtgtctc
                GreenSeaTurtle  cagctgctcagttagtataagtattcagattcccagagaattctaaggaaatgttcccctacagcctttt
                           Dog  cagctgctccgagagcctgacgactcagattcccagagaattctaagcagacggtcctccaccgagtc-c

     Oar_rambouillet_v1_0_addY  ttgttctctcta--atcatcatcattttaaaatttcatc----------cacttttcattccttaataga
                        Rabbit  ttgttctctcta--atcatcatcattttcaaatttcatc----------cactgctcattccttcccaga
                         Horse  ttgttctctcta--atcatcatcattttaaaatttcatc----------cacagttcattccttcataga
               ChinesePangolin  ctgttctttctatcatcatcatcatttaaaaattttatc----------taccgttcattccatcacaga
                         Human  ttgttctctcta--atcatcatcattttaaaatttcatt----------cagcgttcattacttcataga
                      Aardvark  ttgttctctcta--atcatcatcattttaaaatttcatc----------cactgttcattctttcataga
                     BlueWhale  ttgttctctcta--atcatcatcatcttaaaatttcatc----------cacttttcattccgtaataga
       CommonBottlenoseDolphin  ttgttctctcta--atcatcatcatcttaaaatttcatc----------cacttttcattccttaataga
                   BelugaWhale  ttgttctctcta--atcatcatcatcttaaaatttcatc----------cacttttcattccttaataga
                           Pig  ttgttctctcta--atcatcatcattttaaaatttcatc----------cactcttcattcctttacaga
                FloridaManatee  ttgttctctcta--atcgtcatcattttaaaatttcatc----------cactgttcattctttcataga
                       Tuatara  tccttatctgta--tgccccatcatcttaaaatttcagt------------ctgttctctcctctgagca
           GreaterHorseshoeBat  ttgttctctcta--atcatcatcattttaaaatctcatc----------cactgttcattccttcataga
       WesternEuropeanHedgehog  tggctctctcta--atcatcatcatttagaaatttcatt----------cactgctcattcttacatggg
                    HouseMouse  ttag--tctcta--atcatcatcacttgaaaatttcatg----------tgctgttcattcttttacaaa
              ChineseTreeShrew  ttgttctctcta--atcatcatcattttaaaatttcatc----------cactgttcatttcttcataga
                        Alpaca  ttgttctctcta--atcatcatcattttaaaatttcatc----------cactgttcattccttcataga
             WildBactrianCamel  ttgttctctcta--atcatcatcattttaaaatttcgtc----------cactgttcattccttcataga
                  ArabianCamel  ttgttctctcta--atcatcatcattttaaaatttcgtc----------cactgttcattccttcataga
                    MinkeWhale  ttgttctctcta--atcatcatcatcttaaaatttcatc----------cacttttcattccttaataga
                   KillerWhale  ttgttctctcta--atcatcatcatcttaaaatttcatc----------cacttttcattccttaataga
                    SpermWhale  ttgttctctcta--atcatcatcatcttaaaatttcatc----------cacttttcattccttaataga
                ChacoanPeccary  ttgttctctcta--atcatcatcattttaaaatttcatc----------caccgttcattccttcataga
                GreenSeaTurtle  tctatctcaata--ttccccatcattttttaatttcagc----------atgtgctcacccctta-----
                           Dog  tggttctctcta--atcaccatcattttaagattccaccccccccccaaccccggtcgttctttagtgca

     Oar_rambouillet_v1_0_addY  a
                        Rabbit  a
                         Horse  a
               ChinesePangolin  a
                         Human  a
                      Aardvark  a
                     BlueWhale  a
       CommonBottlenoseDolphin  a
                   BelugaWhale  a
                           Pig  a
                FloridaManatee  g
                       Tuatara  g
           GreaterHorseshoeBat  a
       WesternEuropeanHedgehog  a
                    HouseMouse  a
              ChineseTreeShrew  a
                        Alpaca  a
             WildBactrianCamel  a
                  ArabianCamel  a
                    MinkeWhale  a
                   KillerWhale  a
                    SpermWhale  a
                ChacoanPeccary  a
                GreenSeaTurtle  -
                           Dog  c

Alignment block 39 of 177 in window, 129061497 - 129061545, 49 bps 
B D  Oar_rambouillet_v1_0_addY  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 JavaMouseDeer  tagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                         Bongo  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                         Saiga  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                         Gayal  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                    LesserKudu  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                     Sitatunga  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 MountainNyala  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
               LesserMouseDeer  tagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                AlpineMuskDeer  cagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                WesternRoeDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                          Gaur  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 AmericanBison  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                       WildYak  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                   DomesticYak  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  WaterBuffalo  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                AfricanBuffalo  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                   CommonEland  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                   GreaterKudu  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                      Bushbuck  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                        Impala  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                          Suni  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  Klipspringer  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 RoyalAntelope  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                   KirksDikDik  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                      Steenbok  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
            PrzewalskisGazelle  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                         Oribi  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
               ThomsonsGazelle  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 GrantsGazelle  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                       Gerenuk  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                     Springbok  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                MaxwellsDuiker  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 HarveysDuiker  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  CommonDuiker  cactgtgtctcgtccccaggtaattcaggcctgggggaagggttccttc
                 BohorReedbuck  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
              DefassaWaterbuck  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                        Lechwe  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                       Gemsbok  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
            ScimitarHornedOryx  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  RoanAntelope  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                 SableAntelope  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                BlueWildebeest  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                          Topi  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                        Herola  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
               TibetanAntelope  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  MountainGoat  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
               EuropeanMouflon  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                AsiaticMouflon  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                     SnowSheep  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  BighornSheep  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  BarbarySheep  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                        Bharal  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                   NilgiriTahr  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
B D                       ARS1  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                      WildGoat  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  SiberianIbex  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
         ChineseForestMuskDeer  cagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                  BlackMuntjac  cagtgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                 IndianMuntjac  cagtgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                 ReevesMuntjac  cagtgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                PereDavidsDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
               WhiteLippedDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                   YarkandDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                       RedDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                       HogDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
               WhiteTailedDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                      MuleDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                      Reindeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                EasternRoeDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                   EurasianElk  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
              ChineseWaterDeer  cagcgtgtcttgcccccaggtaattcaggcctgggggaggggttccttt
                       Giraffe  cagtgagtcttgtccccaggtaattcaggcctgggggaagggttccttc
                     Pronghorn  cagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccctc
                        Cattle  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                    ZebuCattle  cactgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
              SiberianMuskDeer  cagtgtgtcttgtccccaggtaattcaggcctgggggaagggttccttc
                         Okapi  cagtgagtcttgtccccaggtaattcaggcctgggggaagggttccttc

Alignment block 40 of 177 in window, 129061546 - 129061726, 181 bps 
B D  Oar_rambouillet_v1_0_addY  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 JavaMouseDeer  ttccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                         Bongo  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                         Saiga  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                         Gayal  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                    LesserKudu  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                     Sitatunga  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 MountainNyala  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
               LesserMouseDeer  ttccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                AlpineMuskDeer  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                WesternRoeDeer  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                          Gaur  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 AmericanBison  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                       WildYak  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                   DomesticYak  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  WaterBuffalo  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                AfricanBuffalo  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                   CommonEland  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                   GreaterKudu  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                      Bushbuck  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                        Impala  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                          Suni  ctccagactgattggtgcagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  Klipspringer  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 RoyalAntelope  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                   KirksDikDik  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                      Steenbok  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
            PrzewalskisGazelle  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                         Oribi  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
               ThomsonsGazelle  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                       Gerenuk  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                     Springbok  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                MaxwellsDuiker  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 HarveysDuiker  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  CommonDuiker  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 BohorReedbuck  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
              DefassaWaterbuck  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                        Lechwe  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                       Gemsbok  cttcagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
            ScimitarHornedOryx  cttcagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  RoanAntelope  cttcagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                 SableAntelope  cttcagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                BlueWildebeest  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                          Topi  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                        Herola  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
               TibetanAntelope  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  MountainGoat  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
               EuropeanMouflon  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                AsiaticMouflon  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                     SnowSheep  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  BighornSheep  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  BarbarySheep  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                        Bharal  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                   NilgiriTahr  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
B D                       ARS1  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                      WildGoat  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  SiberianIbex  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
         ChineseForestMuskDeer  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                  BlackMuntjac  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                 IndianMuntjac  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                 ReevesMuntjac  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                PereDavidsDeer  ctccagactgattggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
               WhiteLippedDeer  ctccagactgattggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                   YarkandDeer  ctccagactgattggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                       RedDeer  ctccagactgattggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                       HogDeer  ctccagactgattggtacagctgct-cgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
               WhiteTailedDeer  ctccagactgatcggtacagctgctccgtaagtggaact-ctcagattcccaaagaattctaagtggatg
                      MuleDeer  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                      Reindeer  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaggaattctaagtggatg
                EasternRoeDeer  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                   EurasianElk  ctccagactgattggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
              ChineseWaterDeer  ctccagactgatcggtacagctgctccgtaagtgtaact-ctcagattcccaaagaattctaagtggatg
                       Giraffe  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                     Pronghorn  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                        Cattle  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                    ZebuCattle  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
              SiberianMuskDeer  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg
                         Okapi  ctccagactgattggtacagctgctcagtaagtgtaactactcagattcccaaagaattctaagtggatg

     Oar_rambouillet_v1_0_addY  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 JavaMouseDeer  ttcctccacagtgtctcttgttctctctaatcatcatca-tttcaaaatctcatccacttttcatccctt
                         Bongo  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                         Saiga  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                         Gayal  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                    LesserKudu  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                     Sitatunga  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 MountainNyala  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
               LesserMouseDeer  ttcctccacagtgtctcttgttctctctaatcatcatca-tttcaaaatctcatccacttttcatccctt
                AlpineMuskDeer  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                WesternRoeDeer  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                          Gaur  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 AmericanBison  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                       WildYak  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                   DomesticYak  ttcttccacagtgtctcttgttctctctaatcatcatca-ctttaaaatttcatccacttttcattcctt
                  WaterBuffalo  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                AfricanBuffalo  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                   CommonEland  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                   GreaterKudu  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                      Bushbuck  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                        Impala  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                          Suni  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                  Klipspringer  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 RoyalAntelope  ttcttccacagtgtctcttgttctctctaatcatcatca-tcttaaaatttcatccacttttcattcctt
                   KirksDikDik  ttcttctacagtgtctcttgttctctgtaatcatcatca-ttttaaaatttcatccacttttcattcctt
                      Steenbok  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
            PrzewalskisGazelle  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                         Oribi  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
               ThomsonsGazelle  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                       Gerenuk  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                     Springbok  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                MaxwellsDuiker  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 HarveysDuiker  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                  CommonDuiker  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 BohorReedbuck  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
              DefassaWaterbuck  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                        Lechwe  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                       Gemsbok  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattccct
            ScimitarHornedOryx  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattccct
                  RoanAntelope  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                 SableAntelope  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattccct
                BlueWildebeest  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                          Topi  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                        Herola  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
               TibetanAntelope  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctc
                  MountainGoat  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
               EuropeanMouflon  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                AsiaticMouflon  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                     SnowSheep  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                  BighornSheep  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                  BarbarySheep  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                        Bharal  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                   NilgiriTahr  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                          ARS1  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcgttcctt
                      WildGoat  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcgttcctt
                  SiberianIbex  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcgttcctt
         ChineseForestMuskDeer  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                  BlackMuntjac  ttcttccgcagtgtctcttgttctctctaatcatcatca-tttt-aaatttcatccacttttcattcctt
                 IndianMuntjac  ttcttccgcagtgtctcttgttctctctaatcatcatca-tttt-aaatttcatccacttttcattcctt
                 ReevesMuntjac  ttcttccgcagtgtctcttgttctctctaatcatcatca-tttt-aaatttcatccacttttcattcctt
                PereDavidsDeer  ttcttccgcagtgtctcttgttctctctaatcatcatcatttttaaaatttcatctgcttttcattcctt
               WhiteLippedDeer  ttcttccgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                   YarkandDeer  ttcttccgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                       RedDeer  ttcttccgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                       HogDeer  ttcttccgcagtgtctcttgttctctctaatcatcatcg-ttttaaaatttcatccacttttcattcctt
               WhiteTailedDeer  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                      MuleDeer  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                      Reindeer  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                EasternRoeDeer  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                   EurasianElk  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
              ChineseWaterDeer  ttcttctgcagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                       Giraffe  ttcctccacagtgtctcttgttctctgtaatcatcatca-ttttaaaatttcacccacttttcattcctt
                     Pronghorn  ttcctc--cagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                        Cattle  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                    ZebuCattle  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
              SiberianMuskDeer  ttcttccacagtgtctcttgttctctctaatcatcatca-ttttaaaatttcatccacttttcattcctt
                         Okapi  ttcctccacagtgtctcttgttctctgtaatcatcatca-ttttaaaatttcacccacttttcattcctt

     Oar_rambouillet_v1_0_addY  aatagaattttccttagtccacagttctctggaaaggaagta
                 JavaMouseDeer  aatagaattttccttagtccacagctctgtggagaggaagtt
                         Bongo  aatagaattttccttagtccacagttctctggaaaggaagta
                         Saiga  aatagaatttcccttagtccacagttctctggaaaggaagta
                         Gayal  aatagaattttccttagtccacagttctctggaaaggaagta
                    LesserKudu  aatagaattttccttagtccacagttctctggaaaagaagta
                     Sitatunga  aatagaattttccttagtccacagttctctggaaaggaagta
                 MountainNyala  aatagaattttccttagtccacagttctctggaaaggaagta
               LesserMouseDeer  aatagaattttccttagtccacagctctgtggagaggaagtt
                AlpineMuskDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                WesternRoeDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                          Gaur  aatagaattttccttagtccacagttctctggaaaggaagta
                 AmericanBison  aatagaattttccttagtccacagttctctggaaaggaagta
                       WildYak  aatagaattttccttagtccacagttctctggaaaggaagta
                   DomesticYak  aatagaattttccttagtccacagttctctggaaaggaagta
                  WaterBuffalo  aatagaattttccttagtccacagctctctggaaaggaagta
                AfricanBuffalo  aatagaattttccttagtccacagttctctggaaaggaagta
                   CommonEland  aatagaattttccttagtccacagttctctggaaaggaagta
                   GreaterKudu  aatagaattttccttagtccacagttctctggaaaggaagta
                      Bushbuck  aatagaattttccttagtccacagttctctggaaaggaagtc
                        Impala  aatagaattttccttagtccacatttctccggaaaggaagta
                          Suni  aatagaatttgccttagtccacagttctctggaaaggaagta
                  Klipspringer  aatagaattttccttagtccacagttctctggaaaggaagta
                 RoyalAntelope  aatagaattttccttagtccacagtcctctggaaaggaagta
                   KirksDikDik  aatagaattttccttagtccacagttctctggaaaggaagta
                      Steenbok  aagagaattttccttagtccacagttctctggaaaggaagta
            PrzewalskisGazelle  aatagaattttccttagtccactgtgctctggaaaggaagta
                         Oribi  aaccgaattttccttagtccacagttctctggaaagaaagca
               ThomsonsGazelle  aatagaatttcccttagtccacagttctctgaaaaggaagta
                       Gerenuk  aatagaatttcccttagtccacagttctctggaaaggaagta
                     Springbok  aatagaatttcccttagtccacagttctctggaaaggaagta
                MaxwellsDuiker  aatagaattttccttagtccacagttctctggaaaggaagta
                 HarveysDuiker  aatagaattttccttagtccacggttctttggaaaggaagta
                  CommonDuiker  aatagaattttccttagtccacagttctttggaaaggaagta
                 BohorReedbuck  actcgaattttccttagtccacagttctctggaaaggaagta
              DefassaWaterbuck  actagaattttccttagtccacagttctctggaaaggaagta
                        Lechwe  actcgaattttccttagtccacagttctctggaaaggaagta
                       Gemsbok  aatagaattttccttagtcctcagttctctgaaaaggaagta
            ScimitarHornedOryx  aatagaattttccttagtcctcagttctctgaaaaggaagta
                  RoanAntelope  aatagaattttccttagtccacagttctctgaaaaggaagta
                 SableAntelope  aatagaattttccttagtccacagttctctgaaaaggaagta
                BlueWildebeest  aatagaattttccttagtccacagttctctggaaaggaagta
                          Topi  aatagaattttccttagtccacagttctctggaaaggaagta
                        Herola  aatagaattttccttagtccacagttctctggaaaggaagta
               TibetanAntelope  aatagaattttccttagtccacagttctctggaaaggaagta
                  MountainGoat  aatagaattttccttagtccacagttctctggaaaggaagta
               EuropeanMouflon  aatagaattttccttagtccacagttctctggaaaggaagta
                AsiaticMouflon  aatagaattttccttagtccacagttctctggaaaggaagta
                     SnowSheep  aatagaattttccttagtccacagttctctggaaaggaagta
                  BighornSheep  aatagaattttccttagtccacagttctctggaaaggaagta
                  BarbarySheep  aatagaattttccttagtccacagttctctggaaaggaagta
                        Bharal  aatagaattttccttagtccacagttctctggaaaggaagta
                   NilgiriTahr  aatagaattttccttagtccacagttctctggaaaggaagta
                          ARS1  aatagaattttccttagtccacagttctctggaaaggaagta
                      WildGoat  aatagaattttccttagtccacagttctctggaaaggaagta
                  SiberianIbex  aatagaattttccttagtccacagttctccggaaaggaagta
         ChineseForestMuskDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                  BlackMuntjac  aatagaattttccttagtccacagttctctggaaaggaagta
                 IndianMuntjac  aatagaattttccttagtccacagttctctggaaaggaagta
                 ReevesMuntjac  aatagaattttccttagtccacagttctctggaaaggaagta
                PereDavidsDeer  aatagaattttccttagtccacagttctctggaaaggaagta
               WhiteLippedDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                   YarkandDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                       RedDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                       HogDeer  aatagaattttccttagtccacagttctctggaaaggaagta
               WhiteTailedDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                      MuleDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                      Reindeer  aatagaattttccttagtccacagttctctggaaaggaagta
                EasternRoeDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                   EurasianElk  aatagaattttccttagtccacagttctctggaaaggaagta
              ChineseWaterDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                       Giraffe  aatagaattttccttagtcctcagttctctggaaaggaagta
                     Pronghorn  aatagaatttttcttagtccacagttctctggaaaggaagta
                        Cattle  aatagaattttccttagtccacagttctctggaaaggaagta
                    ZebuCattle  aatagaattttccttagtccacagttctctggaaaggaagta
              SiberianMuskDeer  aatagaattttccttagtccacagttctctggaaaggaagta
                         Okapi  aatagaattttccttagtcctcagttctctggaaaggaagta

Alignment block 41 of 177 in window, 129061692 - 129061736, 45 bps 
B D  Oar_rambouillet_v1_0_addY  ttttccttagtccacagttctctgg-aaagga------agtaggctgctcat
                        Rabbit  ttttccttagcctgcagttccttgg-aagggg------agcagattcttcac
                         Horse  ttttccttagttcacagttttctgg-aaaaga------agtagattcctcat
               ChinesePangolin  -tttcctaagtccacagttctctgg-aaagga--------tagattcttcat
                         Human  ccttcctttgtccatagttctctgg-aagggg------aatagattcctgat
                      Aardvark  ttttctttagtccacccttctctggaaaaaag------agtagattccttat
                     BlueWhale  ttttccttagtccacagttctctgg-agagga------agtaggttcctcct
       CommonBottlenoseDolphin  ttttccttagtccacagttctctgg-agagga------agtaggttcctcct
                   BelugaWhale  ttttccttagtccacagttctctgg-agagga------agtaggttcctcct
                           Pig  ttttctttagtctacagttttctag-aaagga------agtaggtttctcat
                FloridaManatee  ttttccttagtccacagttccttgg-aaaggc------agtagatttcttat
           GreaterHorseshoeBat  ttttccttcgtccataattatctgg-aaaggg------agtggatccttcat
       WesternEuropeanHedgehog  atgttctcagtcgccagatctcttg--gaggg------tgtagagtccttag
                    HouseMouse  tatcccttagcccagagttctctgg-aagggg------agtagaatctacat
              ChineseTreeShrew  ----ctttagtccacagttctctgg-gaaggggagggcagtaggttcctcat
                        Alpaca  ttttccttagttcacagttctctgg-aaagga------agtaggttcctcat
             WildBactrianCamel  ttttccttagttcacagttctctgg-aaagga------agtaggttcctcat
                  ArabianCamel  ttttccttagttcacagttctctgg-aaagga------agcaggttcctcat
                           Dog  ttcacgctaaccc-cggatccctgg-ggaggg------agcagagacctccg
                    MinkeWhale  ttttccttagtccacagttctctgg-agagga------agtaggatactcct
                   KillerWhale  ttttccttagtccacagttctctgg-agagga------agtaggttcctcct
                    SpermWhale  ttttccttagtccacaattctctgg-agagga------agtaggttcctcct
                ChacoanPeccary  ttttttttagtccacagttttctgg-aaagga------agtaggtttctcat

Alignment block 42 of 177 in window, 129061727 - 129061899, 173 bps 
B D  Oar_rambouillet_v1_0_addY  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
                 JavaMouseDeer  ggctgctcataaacagctgaaaaaacatgtatgtaaaaaa-tctgaaaagctatagtaattatt-ttact
                         Bongo  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgttaacact
                         Saiga  ggctgttcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                         Gayal  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                    LesserKudu  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                     Sitatunga  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-acact
                 MountainNyala  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-acact
               LesserMouseDeer  ggctgctcataaacagctgaaaaaacatgtatgtaaaaaa-tctgaaaagctatagtaattatt-ttact
                AlpineMuskDeer  ggctgctcataaacagctgaaaaaacacatacctaaaagattctgaaaagct---ataattctt-atact
                WesternRoeDeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
                          Gaur  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaagaactgtt-atact
                 AmericanBison  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                       WildYak  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                   DomesticYak  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                  WaterBuffalo  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atagt
                AfricanBuffalo  ggctgctcat-aacagctgaaaaaacatataccttaaagattctgaaaagctgtaataactgtt-atact
                   CommonEland  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                   GreaterKudu  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                      Bushbuck  ggctgctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                        Impala  ggctgctcataaacagctgaaaaaacatatacctaaaagagtttgaaaagctgtaataattgtt-atact
                          Suni  ggctgctcataaacagctgaaaaaacatatacctaaaagagtttgaaaagctgtaataattgtt-gtact
                  Klipspringer  ggctgctcataaacagctgaaaaaacgtatacctaaaagattttgaaaagctgtaataattgtt-atatt
                 RoyalAntelope  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-ttact
                   KirksDikDik  ggctgctcataaacag-tgaaaaaacacatacctaaaagattttgaaaagctgtaataattgtt-atact
                      Steenbok  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgct-atatt
            PrzewalskisGazelle  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                         Oribi  ggctgctcaaaaacagatgaaaaatcatatacctaaaatattttgaaaagctgtaataattgtt-atact
               ThomsonsGazelle  ggctgttcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaagaattgtt-atact
                 GrantsGazelle  ggctgttcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaagaattgtt-atact
                       Gerenuk  ggctgttcataaacagctgaaaaaacatatacctaaaagattttgaaaagctataataattgtt-atact
                     Springbok  ggctgttcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgcaataattgtt-atact
                MaxwellsDuiker  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                 HarveysDuiker  ggctgctcataaacagctgaaaaaacatatacctaaaagatttggaaaagctgtaataattgtt-atact
                  CommonDuiker  ggctgctcataaacagctgaaaaaacatatacctaaaagatttggaaaagctgtaataattgtt-atact
                 BohorReedbuck  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
              DefassaWaterbuck  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                        Lechwe  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                       Gemsbok  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
            ScimitarHornedOryx  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                  RoanAntelope  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                 SableAntelope  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                BlueWildebeest  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                          Topi  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                        Herola  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
               TibetanAntelope  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                  MountainGoat  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
               EuropeanMouflon  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
                AsiaticMouflon  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
                     SnowSheep  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
                  BighornSheep  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
                  BarbarySheep  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgacaagctgtaataattgtt-atact
                        Bharal  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                   NilgiriTahr  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
B D                       ARS1  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                      WildGoat  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
                  SiberianIbex  ggctgctcataaacagctgaaaaaacatatacctaaaagattttgaaaagctgtaataattgtt-atact
         ChineseForestMuskDeer  ggctgctcataaacagctgaaaaaacacatacctaaaagattctgaaaagct---ataattctt-atact
                  BlackMuntjac  ggctgctcataaacatctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
                 IndianMuntjac  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-gtact
                 ReevesMuntjac  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-gtact
                PereDavidsDeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
               WhiteLippedDeer  ggctgctcataaacagctgaaaaaacatgtacctaaaagattctgaaaagctataataattgtt-atact
                   YarkandDeer  ggctgctcataaacagctgaaaaaacatgtacctaaaagattctgaaaagctataataattgtt-atact
                       RedDeer  ggctgctcataaacagctgaaaaaacatgtacctaaaagattctgaaaagctataataattgtt-atact
                       HogDeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
               WhiteTailedDeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
                      MuleDeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
                      Reindeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
                EasternRoeDeer  ggcagctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataattgtt-atact
                   EurasianElk  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
              ChineseWaterDeer  ggctgctcataaacagctgaaaaaacatatacctaaaagattctgaaaagctataataattgtt-atact
                       Giraffe  ggcagctcataaacagctgaaaaaacatacacctaaaagattctgaaaagctataataattgtt-atact
                     Pronghorn  ggctgctcataaacagctgaaaaaagatatacctaaaagactctgaaaagctataataattgtt-atact
                        Cattle  ggcttctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
                    ZebuCattle  ggcttctcat-aacagctgaaaaaacatatacctaaaagattctgaaaagctgtaataactgtt-atact
              SiberianMuskDeer  ggctgctcataaacagctgaaaaaacacatacctaaaagattctgaaaagct---ataattctt-atact
                         Okapi  ggcagctcataaacagctgaaaaaccatgcacctaaaagattctggaaagctataataattgtt-atact

     Oar_rambouillet_v1_0_addY  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                 JavaMouseDeer  tgatatttttctgagttatgaatgaaattctacata-ttttttcattttaaaagac-taaatatgcacat
                         Bongo  tgatattttgcc--attatgaatgaagtgctacata-tttttccattttaaaagac-taaatatgcacac
                         Saiga  tgatattttgct--gttatgaatgaaatgctacatattttttccattttaaaagac-taaatatgcacac
                         Gayal  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                    LesserKudu  tgatattttgcc--attatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                     Sitatunga  tgatattttgcc--attatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                 MountainNyala  tgatattttgcc--attatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
               LesserMouseDeer  tgatatttttctgagttatgaatgaaattctacata-ttttttcattttaaaagac-taaatatgcacat
                AlpineMuskDeer  tcatattttgct--gttatgaatgaaattctacata-tttttccactttaaaagac-taaatatgcacac
                WesternRoeDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                          Gaur  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                 AmericanBison  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagat-taaatatgcacac
                       WildYak  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                   DomesticYak  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                  WaterBuffalo  tgatattttgct--gttatgaatgaaatgctacata-tttttctattttaaaagac-taaatatgcacac
                AfricanBuffalo  tgataatttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                   CommonEland  tgatattttgcc--attatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                   GreaterKudu  tgatattttgcc--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                      Bushbuck  tgatattttgcc--attatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                        Impala  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                          Suni  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaagagac-taaatatgcatac
                  Klipspringer  tgatattttgct--gttatgaatgaaatgctgcata-tttttctattttaaaagac-taaatatgcacac
                 RoyalAntelope  tgacattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                   KirksDikDik  tgatattttgct--gttataaatgaaatgttacata-tttttccattttaaaagac-taaatatgcacac
                      Steenbok  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
            PrzewalskisGazelle  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                         Oribi  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
               ThomsonsGazelle  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaacatgcacac
                 GrantsGazelle  tgatattttgct--gttatgaatgaaacgctacata-tttttccattttaaaagac-taaatatgcacac
                       Gerenuk  tgatattttgct--gttatgaatgaaatggtacata-tttttccattttaaaagac-taaatatgcacac
                     Springbok  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                MaxwellsDuiker  tgatattttgct--gtgatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                 HarveysDuiker  tgatattttgct--gtgatgaatgaaatgctacata-cttttccattttaaaagac-taaatatgcacac
                  CommonDuiker  tgatattttgct--gtgatgaatgaaatgctacata-cttttccattttaaaagac-taaatatgcacac
                 BohorReedbuck  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
              DefassaWaterbuck  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagacttaaatatgcacac
                        Lechwe  tgatattttgct--gttatgaatgaaatgctacata-ttttaccattttaaaagac-taaatatgcacac
                       Gemsbok  tgatattttgct--gttatgaatgaaatgccacata-tttttccattttaaaagac-taaatatgcacac
            ScimitarHornedOryx  tgatattttgct--gttatgaatgaaatgccacata-tttttccattttaaaagac-taaatatgcacac
                  RoanAntelope  tgatattttgct--gatatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                 SableAntelope  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                BlueWildebeest  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                          Topi  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                        Herola  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
               TibetanAntelope  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcatac
                  MountainGoat  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
               EuropeanMouflon  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                AsiaticMouflon  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                     SnowSheep  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                  BighornSheep  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                  BarbarySheep  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                        Bharal  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                   NilgiriTahr  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaaaac-taaatatgcacac
                          ARS1  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaaggc-taaatatgcacac
                      WildGoat  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaaggc-taaatatgcacac
                  SiberianIbex  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
         ChineseForestMuskDeer  tcatattttgct--gttatgaatgaaattctacata-tttttccactttaaaagac-taaatatgcacac
                  BlackMuntjac  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                 IndianMuntjac  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                 ReevesMuntjac  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                PereDavidsDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacat
               WhiteLippedDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                   YarkandDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                       RedDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                       HogDeer  tgatattttgct--gtcatgaatgaaatgctacaaa-tttttccattttaaaagac-taagtatgcacac
               WhiteTailedDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                      MuleDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                      Reindeer  tgatattttgct--gccatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                EasternRoeDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                   EurasianElk  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
              ChineseWaterDeer  tgatattttgct--gtcatgaatgaaatgctacata-tttttacattttaaaagac-taaatatgcacac
                       Giraffe  tgatattttgct--gttatgaatgaaattctacata-tttttccattttaaaagac-taaatatgcacac
                     Pronghorn  tgatattttgct--gttatgaatgaaattatacata-tttttccattttaaaggac-taaatatgcacac
                        Cattle  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
                    ZebuCattle  tgatattttgct--gttatgaatgaaatgctacata-tttttccattttaaaagac-taaatatgcacac
              SiberianMuskDeer  tcatattttgct--gttatgaatgaaattctacata-tttttccactttaaaagac-taaatatgcacac
                         Okapi  tgatattttgct--gttatgaatgaaattctacata-tttttccattttaaaagac-taaatatgcacac

     Oar_rambouillet_v1_0_addY  attattccaat-t--taaaaaatgttcatagattgacatgg
                 JavaMouseDeer  attattccaac-----caaaaatgctcactgattaacatgg
                         Bongo  attattccaat-t---aaaaaatgttcatagattgatatgg
                         Saiga  attattccaat-t--aaaaaaatgttcatagactgacatgg
                         Gayal  attattccaat-t-aaaaaaaatgttcatagattgatatgg
                    LesserKudu  attattccaat-t---aaaaaatgttcatagattgatatgg
                     Sitatunga  attattccaat-t---aaaaaatgttcatagattgatatgg
                 MountainNyala  attattccaat-t---aaaaaatgttcatagattgatatgg
               LesserMouseDeer  attattccaac-----caaaaatgctcactgattaacatgg
                AlpineMuskDeer  attattccaat-a---aaaaaatgctcatagattgacatga
                WesternRoeDeer  atgattccactaa---aaaaaatgctcatagattgacatgg
                          Gaur  attattccaat-t--aaaaaaatgttcatagattgatatgg
                 AmericanBison  attattccaat-t--aaaaaaatgttcatagattgatatgg
                       WildYak  attattccaat-t--aaaaaaatgttcatagattgatacgg
                   DomesticYak  attattccaat-t--aaaaaaatgttcatagattgatacgg
                  WaterBuffalo  attattccaat-t--aaaaaaatgttcatagattgatatgg
                AfricanBuffalo  attattccaat-t--aaaaaaatgttcatagattgatatgg
                   CommonEland  attattccaat-t---aaaaaatgttcatagattgatatgg
                   GreaterKudu  attattccaat-t--aaaaaaatgttcatagattgatatgg
                      Bushbuck  attattccaat-t---aaaaaatgttcatagattgatatgg
                        Impala  attattccaat-t--aaaaaaatgttcatagattgacgtgg
                          Suni  attattccaat-t--taaaaaatgttcatagattgatatgg
                  Klipspringer  attattccaat-t--aaaaaaatgttcatagattgacatgg
                 RoyalAntelope  attattccaat-t--taaaaaatgttcatagattgacatgg
                   KirksDikDik  attattccaa--t--tataaaatgttcatagattgacatgg
                      Steenbok  attattccaat-t--taaaaaatgttcatagattgacatgg
            PrzewalskisGazelle  attattccaat-t--aaaaaaatgttcaaagactgacatgg
                         Oribi  attattccaat-t--aaaaaaatgttcatagattgacatgg
               ThomsonsGazelle  attattccaat-t--aaaaacatgttcatagattgacatgg
                 GrantsGazelle  attattccaat-t--aaaaaaatgttcatagattgacatgg
                       Gerenuk  attattccaat-t--aaaaaaatgttcatagattgacatgg
                     Springbok  attattccaat-t--aaaaaaatgttcatagattgacatgg
                MaxwellsDuiker  gttattccaat-t--aaaaaaatgttcatagattgacatgg
                 HarveysDuiker  attattccaat-t--aaaaaaatgttcatagattgacatgg
                  CommonDuiker  attattccaat-t--aaaaaaatgttcatagattgacatgg
                 BohorReedbuck  attgttccaat-t-aaaaaaaatgttcatagattgacatgg
              DefassaWaterbuck  attgttccagt-t-aaaaaaaatgttcatagattgacatgg
                        Lechwe  actgttccagt-taaaaaaaaatgttcatagattgacatgg
                       Gemsbok  attattccaat-t--aaaaaaatgttcctagattgacatgg
            ScimitarHornedOryx  attattccaat-t--aaaaaaatgttcctagattgacatgg
                  RoanAntelope  attattccaat-t---aaaaaatgttcatagattgacatgg
                 SableAntelope  attattccaat-t--taaaaaatgttcatagattgacatgg
                BlueWildebeest  attattccaat-t--aaaaaaatgttcatagattgacatgg
                          Topi  attattccaat-t--taaaaaatgttcatagattgacatgg
                        Herola  attattccaat-t--taaaaaatgttcatagattgacatgg
               TibetanAntelope  attattccaat-t--aaaaaaatgttcatagattgacatgg
                  MountainGoat  attattccaat-t--taaaaaatgttcatagattgacgtgg
               EuropeanMouflon  attattccaat-t--taaaaaatgttcatagattgacatgg
                AsiaticMouflon  attattccaat-t--taaaaaatgttcatagattgacatgg
                     SnowSheep  attattccaat-t--taaaaaatgttcatagattgacatgg
                  BighornSheep  attattccaat-t--taaaaaatgttcatagattgacatgg
                  BarbarySheep  attattccaat-t--aaaaaaatgttcatagattgacacgg
                        Bharal  attattccaat-t--aaaaaaatgttcatagattgacatgg
                   NilgiriTahr  attattccaat-t--aaaaaaatgttcatagattgacatgg
                          ARS1  agtattccaat-t---aaaaaatgttcatagattgacatgg
                      WildGoat  attattccaat-t---aaaaaatgttcatagattgacatgg
                  SiberianIbex  attattccaat-t--aaaaaaatgttcatagatggacatgg
         ChineseForestMuskDeer  attattccaat-a---aaaaaatgctcatagattgacatga
                  BlackMuntjac  attattccact-a---aaaaaatgctcatagattgacatgg
                 IndianMuntjac  attattccact-a---aaaaaatgctcatagattgacatgg
                 ReevesMuntjac  attattccact-a---aaaaaatgctcatagattgacatgg
                PereDavidsDeer  gttcttccact-a---aaaaaatgctcatagattgacatgg
               WhiteLippedDeer  atttttccact-a---aaaaaatgctcatagattgacatgg
                   YarkandDeer  attcttccact-a---aaaaaatgctcatagattgacatgg
                       RedDeer  attcttccact-a---aaaaaatgctcatagattgacatgg
                       HogDeer  attcttccact-a---aaaaaatgctcatagattgacatgg
               WhiteTailedDeer  attattccact-a---aaaaaatgctcatagattgacatgg
                      MuleDeer  attattccact-a---aaaaaatgctcatagattgacatgg
                      Reindeer  attattccact-a---aaaaaatgctcatagattgacatgg
                EasternRoeDeer  atgattccactaa---aaaaaatgctcatagattgacatgg
                   EurasianElk  attattccact-a---aaaaaatgctcatagattgtcatgg
              ChineseWaterDeer  attattccact-a---aaaaaatgctcatagattgacatgg
                       Giraffe  attattccaat-a---aaaaaatgctcacagattgacatgg
                     Pronghorn  attattccaat-t---taaaaatgctcatagactgacatgg
                        Cattle  attattccaat-t---aaaaaatgttcatagattgatatgg
                    ZebuCattle  attattccaat-t---taaaaatgttcatagattgatatgg
              SiberianMuskDeer  attattccaat-a---aaaaaatgctcatagattgacatga
                         Okapi  attattccaat-a---aaaaaatgctcacagattgacatgg

Alignment block 43 of 177 in window, 129061738 - 129061878, 141 bps 
B D  Oar_rambouillet_v1_0_addY  aacagctgaaaaaacatatacc----t-aaaagattttgacaagctgtaataattgttatacttga-ta-
                        Rabbit  aatggttgaaagtacctatgtc----t-aaagaattctgaaaagccagactaattattttccttga-ta-
                         Horse  aacagctgaaaaa--acatata----t-caaaaattctgaaaggctagagtaattatattctttga-ta-
               ChinesePangolin  agcagctaaaaaa-tatgtatc----t-aaaaaattctgaaatgccatattaattatcttatttgc-ta-
                         Human  aacagctgaaaatacatacgtc----t-gaaaaattctgaaaagctagggtaattattttctttga-ca-
                      Aardvark  aataaatgaaaaggcatacatc----t-aaaaagttctgaaaagctggagtaattatttgattt------
                     BlueWhale  aacagctgaaaaaacatacatc----t-aaggaaatctgaaaagctatagtaattattttatttga-ta-
       CommonBottlenoseDolphin  aacagctgaaaaaacatacatc----t-aagaaaatctgaaaagctatagtaattattttatttga-ta-
                   BelugaWhale  aacagctgaaaaaacatacatc----t-aagaaaatctgaaaagctatagtaattattttatttga-ta-
                           Pig  aacagctgaaaaaacat--att----g-aaaaaaatctgaaaagctatagtaattatttcatttga-ta-
                FloridaManatee  aacaaatgaaaaaacatatatc----t-agaaagttctggaaagctagagtaattgttttctttga-tt-
           GreaterHorseshoeBat  aacagctgaaaaaacatgtatc----a-aaaaaattctgaaaagctagagtaattattttctttga-ta-
       WesternEuropeanHedgehog  cacagctgaaaaaacactca-c----t-gaaaaattctgaaaagtta----aattctttccttggg-ta-
                    HouseMouse  aacaggtgaaaatacagatgtcaaaaa-aaaaaattctgaaaagctagagcaactattttctctga-tg-
              ChineseTreeShrew  aacagttgaaaatacagatacc----t-accaaattctaaaaagctaga------attttctttga-tat
                        Alpaca  aacagctgaaaaaaaatagagc----c--aaaaattctaaacagctatagtagctattttgtttga-ta-
             WildBactrianCamel  aacagctgaaaaaaaatagagc----c--aaaaattctaaacagctatagtagctattttgtttgattt-
                  ArabianCamel  aacagctgaaaaaaaatagagc----c--aaaaattctaaacagctatagtagctattttgtttga-tt-
                           Dog  aaaagctgaaaaaatacgtatc----tgaaaaaactctgcaaagctggaacaattattttctttga-ta-
                    MinkeWhale  aacagctgaaaaaacatacatc----t-aagaaaatctgaaaagctatagtaattattttatttga-ta-
                   KillerWhale  aacagctgaaaaaacatacatc----t-aagaaaatctgaaaagctatagtaattattttatttga-ta-
                    SpermWhale  aacagctgaaaaaacatacatc----t-aagaaaatctgaaaagctacagtaattat----tttga-ta-
                ChacoanPeccary  aacagctgagaaaacatatact----g-aaaaaaatctg-aaagctatagtaattat----tttgt-ta-

     Oar_rambouillet_v1_0_addY  -tttt-gct-------------gttatgaatgaaatgctacata---tttttccattttaaaaga-ctaa
                        Rabbit  -ttttctcg-----------gtattatgaatgaagttttaccta---gtatttcatt----------tac
                         Horse  -tttt-tct-----------gagttatgaatgaaattctacata---gtttttcactttaaaaga-ctaa
               ChinesePangolin  -tttt-tct-----------gaattatgaatgagattctacata---gtttttcactttaaaaaa-ctaa
                         Human  -tttt-ttt-----------gagtt----ataaagttccacacg---gtatttcattttaaaaga-ctgc
                      Aardvark  -tttt-tct-----------gagttatgaatgaagtgtttcaaa---atacttaattttaaaata-atgt
                     BlueWhale  -gttt-tct-----------gagttatgaatgaaattctacatatt-ttttttcattttaaaaga-ctag
       CommonBottlenoseDolphin  -gttt-tct-----------gagttatgaatgaaattctacagatt-ttttttcattttaaaaga-ctaa
                   BelugaWhale  -gttt-tct-----------gagttatgaatgaaattctacatatttttttttcattttaaaaga-ctaa
                           Pig  -tttt-tct-----------gaattatgaatgaaattctaca-----gtttttcattttaaaaga-ctaa
                FloridaManatee  -tttt-tct-----------gagttatgaatgaacttctacata---gaatttaattttaaaaga-ctgc
           GreaterHorseshoeBat  ttttt-tct-----------gagttatgaatgaaattctac--a---gttttttattttaaaaga-ctag
       WesternEuropeanHedgehog  ttttt-ttgggggaggggaagagttatgaatgaaattctac--c---attctctgtttccaaaga-ctaa
                    HouseMouse  tttct-tct-----------gaactatgaatgaagttccacata---atattttattttaaaaga-ccac
              ChineseTreeShrew  ttttt-tct-----------gtgttataaatgaaactatacata---gtatttcattttaaaaaaggcaa
                        Alpaca  -tttt-ttt-----------gagttatgaatgaaattctacata---gtttttcacttaagaaga-ct-a
             WildBactrianCamel  -tttt-ttt-----------gagttatgaatgaaattctacata---gtttttcacttaagaaga-ct-a
                  ArabianCamel  -tttt-ttt-----------gagttatgaatgaaattctacata---gtttttcacttaagaaga-ct-a
                           Dog  -tttt-tct-----------gatttatgaatgaaattctgcatg---gtttttcactttaa--------a
                    MinkeWhale  -gttt-tct-----------gagttatgaatgaaattctacatatt-ttttttcattttaaaaga-ctaa
                   KillerWhale  -gttt-tct-----------gagttatgaatgaaattctacatatt-ttttttcattttaaaaga-ctaa
                    SpermWhale  -gttt-tct-----------gagttatgaatgaaattctacatatt-ttttttcattttaaaaga-ctaa
                ChacoanPeccary  --ttt-ttt-----------gaattatgaatgaaattctaca-----atttttaattttaaaaga-ctaa

     Oar_rambouillet_v1_0_addY  atatgcacacat--tattccaa-ttt--a---aaa-
                        Rabbit  atatgcatgcat--tatcccaa-tag--a---aaaa
                         Horse  atatatattcag--tattccaa-tggaaa---aaaa
               ChinesePangolin  aaatgcattcat--cattccaa-tgg--a---aaaa
                         Human  ataggcatacat--tatcttaattta--a---aaaa
                      Aardvark  ----gcaca-----taattcacatgg--g---aaac
                     BlueWhale  ttgtgcacacat--tattccaa-t--------aaac
       CommonBottlenoseDolphin  atgtgcacacat--tattccaa-t--------aaac
                   BelugaWhale  atgtgcacacat--tattccaa-t--------aaac
                           Pig  atatgcatgcac--tattccaa-tag--a---aaaa
                FloridaManatee  atatgtatacat--tattcaaa-taa--g---aaaa
           GreaterHorseshoeBat  atatgcaatcat--tcatccca-tag--a---aaa-
       WesternEuropeanHedgehog  atgtgcattcgt--tagtccaa-tag--a---aaa-
                    HouseMouse  atacgtacacac--tacccca---------------
              ChineseTreeShrew  aaatgtacatataatatcccag-tgt--g---tat-
                        Alpaca  atatgtatttat--ta-ttcaa-tag--a---aaa-
             WildBactrianCamel  ataagtatttat--ta-ttcaa-tag--a---aaa-
                  ArabianCamel  ataagtatttat--ta-ttcaa-tag--a---aaa-
                           Dog  atatgcattcac--tagtccaa-tgg--ggacaaa-
                    MinkeWhale  atatgcacacat--tattccaa-t----a---aac-
                   KillerWhale  atgtgcacacat--tattccaa-c----a---aac-
                    SpermWhale  atgtgcacacat--tattccaa-t----a---aac-
                ChacoanPeccary  atatgcatactt--tattccaa-cagaaa---aaa-

Alignment block 44 of 177 in window, 129061880 - 129061937, 58 bps 
B D  Oar_rambouillet_v1_0_addY  atgttcatagattgacatgga-ggcg-ttcgttca--ttt-tt--cat-aaaaatgatcttagtaa
                        Rabbit  atacccaactattagtaagga-gggattttgttaa--cttatt--aatgaaaaataatttcaggaa
                         Horse  atgttcaccaactaatatgga-aggg-tttactaa--ttt-tt--tatgataaataatttcaataa
               ChinesePangolin  atgctcaccaattaatataaa-ggag-tttgttca--ttt-ct--tatgagaaaaaacttcaataa
                         Human  atgctcaactattaatatgga-ggggttttg----------tt--aatgggaaataatttcagcaa
                      Aardvark  aagcccaccaattaatacgaa-ggtgttttgttta--ctc-tt--aatggggaataatttcagtaa
                     BlueWhale  atgctcattgattaatatgga-ggag-tttattca--tct-gt--catgaaaaatgatttcagtaa
       CommonBottlenoseDolphin  atgctcattgattaatatgga-ggac-ttcatgca--tct-gt--catgaaaaatgatttcagtaa
                   BelugaWhale  atgctcattgattaatatgga-ggag-tttatgca--tct-gt--catgaaaaatgatttcagtaa
                           Pig  aagctcactgattaatatgaa-ggag-tttgttca--ttt-tt--catgaaaca--atttcaataa
                FloridaManatee  atgtccaccaattaa-----g-gggt-tttgttta--ctt-tt--tatggggaataatttcagtaa
           GreaterHorseshoeBat  atgctcaccaattagttatgatgggg-gttgttca--ttg-tt--tatgagaaataatttcagtaa
                    HouseMouse  ----acagctgatgttaaggagtgag-tttatttg--tgt-tt-tgatggggcctgatgtcagtca
              ChineseTreeShrew  atgcacagctattaatatggaaaggt-tttgttca--ttt-ttaaaatgagaaatacttttagtaa
                        Alpaca  atgctcactgattaatatgga-gggg-tttgttca---tt-tt--catgaaaaataatctcaataa
             WildBactrianCamel  atgctcactgattaatatgga-gggg-tttgttca---tt-tt--catgaaaaataaactcaataa
                  ArabianCamel  atgctcactgattaatatgga-gggg-tttgttca---tt-tt--catgaaaaataatctcaataa
                           Dog  aggctcaccaattaacataaa-ggga-cttgttgattttt-tt--tatgagaaataatttcaatga
                    MinkeWhale  atgctcattgattaatatgga-ggag-tttattca--cct-gt--catgaaaaatgatttcagtaa
                   KillerWhale  atgctcattgattaatatgga-ggag-tttatgca--tct-gt--catgaaaaatgatttcagtaa
                    SpermWhale  atgctcattgattaatatgga-ggag-tttattca--tct-gt--catgaaaaatgatttcagtaa
                ChacoanPeccary  atgctcactgattaatataca-ggag-tttgttca--ttt-tt--catgaaagataatttcaataa

Alignment block 45 of 177 in window, 129061900 - 129061966, 67 bps 
B D  Oar_rambouillet_v1_0_addY  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                 JavaMouseDeer  aggggtttgctca--tttttcatgaaaaatgatcttagt--aacttttttttcttatttgtt--tatagc
                         Bongo  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                         Saiga  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattaatt--tatagc
                         Gayal  aggtgttcgttcg--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                    LesserKudu  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aacttttttttcttactcatt--tatagc
                     Sitatunga  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                 MountainNyala  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aacttttttttcttattcatt--tatagc
               LesserMouseDeer  aggggtttgctca--tttttcatgaaaaatgatcttagt--aacttttttttcttattcgtt--tatagc
                AlpineMuskDeer  aggcgttcgttca--tttttcat-aaaaattatcttagt--aacttttttttcttattcatt--tatagc
                WesternRoeDeer  aggcatttgttca--tttttcat-aaaaatgatcttcat--aac-tttttttcttattcatt--tgtagc
                          Gaur  aggtgttcgttcg--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                 AmericanBison  aggtgttcgttcg--tttttcat-aaaaatgatcttagt--aacctttttttcttattcatt--tatagc
                       WildYak  aggtgttcgttcg--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                   DomesticYak  aggtgttcgttcg--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                  WaterBuffalo  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                AfricanBuffalo  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                   CommonEland  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                   GreaterKudu  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                      Bushbuck  aggtgttcgttca--tttttcat-gaaaatgatcttagt--aacttttttttcttattcatttatatagc
                        Impala  aggcgtttgttca--tttttcat-aaaaatgatcttagt--aacttttttttcttatccatt--tatagc
                          Suni  aggcatttgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttatccatt--tatagc
                  Klipspringer  aggtgtttgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                 RoyalAntelope  aggtgtttgttca--tttttcat-taaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                   KirksDikDik  aggcatttgttca--tttttcat-aaaaatgatcttagttaact-tttttttcttattcatt--tatagc
                      Steenbok  aggcgttcgttca--tttttcat-aaaaatgatcttagt--agc--ttttttcttattcatt--tatagc
            PrzewalskisGazelle  aggcgtttgttca--tttttcat-aaaaatgatcttagt--aac--ttttttcttattcatt--tatagc
                         Oribi  aggcattcgttca--tttctcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
               ThomsonsGazelle  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac--ttttttcttattcatt--tatagc
                 GrantsGazelle  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac--ttttttcttattcatt--tatagc
                       Gerenuk  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac--ttttttcttattcatt--tatagc
                     Springbok  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                MaxwellsDuiker  aggagttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                 HarveysDuiker  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                 BohorReedbuck  aggtgtttgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
              DefassaWaterbuck  aggtgtttgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                        Lechwe  aggtgtttgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                       Gemsbok  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
            ScimitarHornedOryx  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                  RoanAntelope  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                 SableAntelope  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                BlueWildebeest  aggcattcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                          Topi  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac--ttttttcttattcatt--tatagc
                        Herola  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
               TibetanAntelope  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                  MountainGoat  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-ttttttccttattcatt--tatagc
               EuropeanMouflon  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                AsiaticMouflon  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                     SnowSheep  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                  BighornSheep  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                  BarbarySheep  aggcgtgcgttca--tttttcgt-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                        Bharal  aggcgttcgttcc--tttttcgt-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                   NilgiriTahr  aggcgtccgttca--tttttcgt-aaaaatgatcttagt--aac-tttttctcttattcatt--tatagc
B D                       ARS1  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-ttttt-tcttattcatt--tatagc
                      WildGoat  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                  SiberianIbex  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
         ChineseForestMuskDeer  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                  BlackMuntjac  aggtgtttgttca--tttttcat-aaaaattatctttgt--aac-tttttttcttattcatt--tgtagc
                 IndianMuntjac  aggtgtttgttca--tttttcat-aaaaattatctttgt--aac-ttttttccttattcatt--tgtagc
                 ReevesMuntjac  aggtgtttgttca--tttttcat-aaaaattatctttgt--aac-tttttttcttattcatt--tgtagc
                PereDavidsDeer  aggtgtttgttca--tttttcat-aaaaatgatcttcct--aac-tttttttcttattcatt--tatagc
               WhiteLippedDeer  aggtgtttgttca--ttttccat-aaaaatgatcttcct--aac-tttttttcttattcatt--tatagc
                   YarkandDeer  aggtgtttgttca--ttttccat-aaaaatgatcttcct--aac-tttttttcttattcatt--tatagc
                       RedDeer  aggtgtttgttca--ttttccat-aaaaatgatcttcct--aac-tttttttctttttcatt--tatagc
                       HogDeer  aggtgtttgttca--ttttccat-aaaaatgatcttcct--aac-tttttttcttattcatt--tatagc
               WhiteTailedDeer  aggcatttgttca--tttttcat-aaaaatgatcttcgt--aac-tttttttcttattcatt--tgtagc
                      MuleDeer  aggcatttgttca--tttttcat-aaaaatgatcttcgt--aac-tttttttcttattcatt--tgtagc
                      Reindeer  aggcatttgttca--tttttcat-aaaaatgatcttcgt--aac-tttttttcttattcatt--tgtagc
                EasternRoeDeer  aggcatttgttca--tttttcat-aaaaatgatcttcgt--aac-tttttttcttattcatt--tgtagc
                   EurasianElk  aggcgtttgttca--tttttcat-aaaaatgatcttcgt--aac-tttttttcttattcatt--tgtagc
              ChineseWaterDeer  aggcatttgttcatttttttcat-aaaaatgatcttcgt--aac-tttttttcttattcatt--tgtagc
                       Giraffe  aggtgtttgttca--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                     Pronghorn  aggcgtttgttca--tttttcat-aaaaatgatcttagt--aac-tttttcccttcttcatt--tatagc
                        Cattle  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
                    ZebuCattle  aggtgttcgttca--tttttcat-aaaaatgatcttagt--aac-tttttttcttattcatt--tatagc
              SiberianMuskDeer  aggcgttcgttca--tttttcat-aaaaatgatcttagt--aacttttttttcttattcatt--tatagc
                         Okapi  aggtgtttgttca--tttttcat-aaaaatgatcttagt--aactttttcttcttattcatt--tatagc

     Oar_rambouillet_v1_0_addY  tgatc
                 JavaMouseDeer  tgatc
                         Bongo  tgatc
                         Saiga  tga--
                         Gayal  tgatc
                    LesserKudu  tgatc
                     Sitatunga  tgatc
                 MountainNyala  tgatc
               LesserMouseDeer  tgatc
                AlpineMuskDeer  tgatc
                WesternRoeDeer  tgatc
                          Gaur  tgatc
                 AmericanBison  tgatc
                       WildYak  tgatc
                   DomesticYak  tgatc
                  WaterBuffalo  tgatc
                AfricanBuffalo  tgatc
                   CommonEland  tgatc
                   GreaterKudu  tgatc
                      Bushbuck  tgatc
                        Impala  tgatc
                          Suni  tgatc
                  Klipspringer  tgatt
                 RoyalAntelope  tgatc
                   KirksDikDik  tgatc
                      Steenbok  tgatc
            PrzewalskisGazelle  tgatc
                         Oribi  tgatc
               ThomsonsGazelle  tgatc
                 GrantsGazelle  tgatc
                       Gerenuk  tgatc
                     Springbok  tgatc
                MaxwellsDuiker  tgatt
                 HarveysDuiker  tgatt
                 BohorReedbuck  tgatc
              DefassaWaterbuck  tgatc
                        Lechwe  tgatc
                       Gemsbok  tgatc
            ScimitarHornedOryx  tgatc
                  RoanAntelope  tgatc
                 SableAntelope  tgatc
                BlueWildebeest  tga--
                          Topi  tga--
                        Herola  tga--
               TibetanAntelope  tgatc
                  MountainGoat  tgatc
               EuropeanMouflon  tgatc
                AsiaticMouflon  tgatc
                     SnowSheep  tgatc
                  BighornSheep  tgatc
                  BarbarySheep  tgatc
                        Bharal  tgatc
                   NilgiriTahr  tgatc
                          ARS1  tgatc
                      WildGoat  tgatc
                  SiberianIbex  tgatc
         ChineseForestMuskDeer  tgatc
                  BlackMuntjac  tgatc
                 IndianMuntjac  tgatc
                 ReevesMuntjac  tgatc
                PereDavidsDeer  tgatc
               WhiteLippedDeer  tgatc
                   YarkandDeer  tgatc
                       RedDeer  tgatc
                       HogDeer  tgatc
               WhiteTailedDeer  tgatc
                      MuleDeer  tgatc
                      Reindeer  tgatc
                EasternRoeDeer  tgatc
                   EurasianElk  tgatc
              ChineseWaterDeer  tgatc
                       Giraffe  tgatc
                     Pronghorn  tgatc
                        Cattle  tgatc
                    ZebuCattle  tgatc
              SiberianMuskDeer  tgatc
                         Okapi  tgatc

Alignment block 46 of 177 in window, 129061938 - 129061958, 21 bps 
B D  Oar_rambouillet_v1_0_addY  ctttt----tttcttattca-tttat
                        Rabbit  -ctct----tgtcttattcg-tttat
                GreenSeaTurtle  ctatt----ctttccattca-tttat
                         Horse  ctttttct-tttcttattca-tttat
               ChinesePangolin  ctttttctgttttttactct-tttat
                         Human  tttct----tttcttattca-tttat
                      Aardvark  ttttt----tttcttattca-tttat
                     BlueWhale  ttttt----tttcttattca-tttat
       CommonBottlenoseDolphin  ttttt----tttcttattca-tttat
                   BelugaWhale  ttttt----tttcttattca-tttat
                           Pig  tttct----ttttttactca-ttttt
                FloridaManatee  ttttt----tttcttattca-tttat
                       Tuatara  ctact----ctttccattta-tttat
                ChacoanPeccary  --tct----ttttttattca-ttttt
                    SpermWhale  --ttt----tttcttattca-tttat
                   KillerWhale  --ttt----tttcttattca-tttat
                    MinkeWhale  --ttt----tttcttattca-tttat
                           Dog  --tct----tttctttttcg-tttat
                  ArabianCamel  --tct----tttcttattca-tttat
             WildBactrianCamel  --tct----tttcttattca-tttat
                        Alpaca  --tct----tttcttattca-tttat
                    RockPigeon  --gtt----ctttccattca-tttat
              ChineseTreeShrew  --caa----tttcttattca-tttat
                    HouseMouse  --ttt----cttcttattcc-tttgt
            TropicalClawedFrog  ---tt----tttttttttcattttac
                  MonkParakeet  ---tt----ctttccattca-tttat
B                      chicken  ---tt----ctttccattca-tttat
       WesternEuropeanHedgehog  ---tt----ttcttaactca-tttac
           GreaterHorseshoeBat  ---tt----ttcttaa-tca-tttat
                      Platypus  ----------------------ttgc

Alignment block 47 of 177 in window, 129061959 - 129062355, 397 bps 
B D  Oar_rambouillet_v1_0_addY  agctgatcttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaatttagctctaagatacaa
                        Rabbit  agctgattttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                      Platypus  agcggggctcctgtggcaggcggaagggaggcccaagtgctgcttcttcaggttgagcccccggatccag
                GreenSeaTurtle  agctgattttcttgtgcaaatggaggggaaaccaaaatgttgcttctttaagtttagctctaaaatacaa
                         Horse  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
               ChinesePangolin  agctgaccttctagtgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                         Human  agctgattttctaatgcaagtggatggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                      Aardvark  agctgattttctaatgcaagtggaaggaaaacccaagtgttgcttctttaaatttagctctaaaatacaa
B                    zebrafish  agctgaccccattgttcaagtagatcggaaaccgaagtgttgctttttctccttcagtccgaagatccaa
                     BlueWhale  agctgatcttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
       CommonBottlenoseDolphin  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                   BelugaWhale  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                           Pig  agctgatcttctaatgcaagtggaaggaaaacccaaatgctgcttctttaaatttagctctaaaatacaa
                FloridaManatee  agctgattttctcatgcaagtggaaggaaaacccaagtgttgcttctttaaatttagctctaaaatacaa
                       Tuatara  agctgattttcctgtgccaatggaaggaaaaccaaaatgttgcttctttaagtttagctctaaaatacag
           GreaterHorseshoeBat  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
       WesternEuropeanHedgehog  agccgatcttctcatgcaagcagaaggaaagcataaatgctgtttctttaaattcagctctaaaatacaa
B                      chicken  agctgattttcttgtacaaatggagggaaaaccaaaatgttgcttctttaagtttagctctaaaatacaa
                  MonkParakeet  agctgattttcttgtccaaatggagggaaaaccaaaatgttgcttctttaagtttagctctaaaatacaa
                    HouseMouse  agctgactttctaatgcaagcggatggcaagcccaaatgttgcttttttaaatttagctctaaaatacag
              ChineseTreeShrew  agctgattctctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacag
                    RockPigeon  agctgattttcttgtacaaatggagggaaaaccaaaatgttgcttctttaagtttagctctaaaatccaa
            TropicalClawedFrog  agttggaatttccattgatatgaaagaaaaacctatttgttgcttttttaaattcagttctaaagttcag
                        Alpaca  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaagtttagctctaaaatacaa
             WildBactrianCamel  agctgatcttctaatgcaagtagaaggaaaacccaaatgttgcttctttaagtttagctctaaaatacaa
                  ArabianCamel  agctgatcttctaatgcaagtagaaggaaaacccaaatgttgcttctttaagtttagctctaaaatacaa
                           Dog  agctgatcttctcatgcaagtggaaggaaaacccaaatgttgtttctttaagtttagctctaaaatacaa
                    MinkeWhale  agctgatcttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                   KillerWhale  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                    SpermWhale  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                ChacoanPeccary  agctgatcttctaatgcaagtggaaggaaaacccaaatgttgcttctttaaatttagctctaaaatacaa
                    Coelacanth  ----------------catgtggaaggcaaaccggtgtgttgtttctttaagttcagcccccaagtacag

     Oar_rambouillet_v1_0_addY  cacaataaagtagtaaaggcccaactgtggatatatctgagacctgtca---agactcctacaacagtgt
                        Rabbit  tacaataaagtagtaaaggcacaactatggatatatctgagacccgtga---agactcctacaacagtgt
                      Platypus  cccaacaaggtgctcaaggcccggctctgggtccacctgcggcccgtcc---tcaagcccaccaccgtct
                GreenSeaTurtle  tataacaaagtagtaaaggcccagttgtggatttacttgaggcaagtcc---agaaacctacaacagtat
                         Horse  tacaataaagtagtaaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
               ChinesePangolin  tacaataaagtagtaaaggcccaactgtggatatatctgagacctgtca---agactcctacaacagtgt
                         Human  tacaataaagtagtaaaggcccaactatggatatatttgagacccgtcg---agactcctacaacagtgt
                      Aardvark  tataataaagtagtcaaggcccaactgtggatatatctgagacctgtga---agactcctacaacggtgt
                     zebrafish  gcgaaccggatcgtaagagcgcagctctgggttcatctgagaccggcgg---aggaggcgaccaccgtct
                     BlueWhale  tacaataaagtagtaaaggcccaactgtggatatatctgaggccagtca---agactcctacaacagtgt
       CommonBottlenoseDolphin  tacaataaagtagtaaaggcccaactgtggatatatctgaggccagtca---agactcctacaacagtgt
                   BelugaWhale  tacaataaagtagtaaaggcccaactgtggatatatctgaggccagtca---agactcctacaacagtgt
                           Pig  tacaataaagtagtaaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
                FloridaManatee  tacaataaggtagtaaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
                       Tuatara  tacaataaagtagtgaaggcccaattgtggatacacttaagacaagttc---agaaacctacaacagtaa
           GreaterHorseshoeBat  tacaataaagtagtgaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
       WesternEuropeanHedgehog  tacaataaagtagtcaaggcccagctgtggatctacctgagccctgtca---agagccctacaacagtgt
                       chicken  tataacaaagtagtaaaggcacaattatggatatacttgaggcaagtcc---aaaaacctacaacggtgt
                  MonkParakeet  tataacaaagtagtaaaggcacaattgtggatatacttgaggcaagtcc---aaaaacctacaacagtgt
                    HouseMouse  tacaacaaagtagtaaaagcccaactgtggatatatctcagacccgtca---agactcctacaacagtgt
              ChineseTreeShrew  tacaataaagtagtaaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
                    RockPigeon  tataacaaagtagtaaaggcacaattgtggatatacttgaggcaagtcc---aaaaacctacaacggtgt
            TropicalClawedFrog  ttgacaaaaatatcgaaagcacagctctggatacatttaaaacctgttc---aaaaacctacgacagttg
                        Alpaca  tataataaagtagtaaaggcccaattgtggatctatctgagacccgtcc---agactcctacaacagtgt
             WildBactrianCamel  tacaataaagtagtaaaggcccaattgtggatctatctgagacccgtcc---agactcctacaacagtgt
                  ArabianCamel  tacaataaagtagtaaaggcccaattgtggatctatctgagacccgtac---agactcctacaacagtgt
                           Dog  tataataaagtagtaaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
                    MinkeWhale  tacaataaagtagtaaaggcccaactgtggatatatctgaggccagtca---agactcctacaacagtgt
                   KillerWhale  tacaataaagtagtaaaggcccaactgtggatatatctgaggccagtca---agactcctacaacagtgt
                    SpermWhale  tacaataaagtagtaaaggcccaactgtggatatatctgaggccagtca---agactcctacaacagtgt
                ChacoanPeccary  tacaataaagtagtaaaggcccaactgtggatatatctgagacccgtca---agactcctacaacagtgt
                    Coelacanth  tacagcagggtggtaaaagctcagctctggatacatcttaaacccatcgatcagaagcaaacaacagtaa

     Oar_rambouillet_v1_0_addY  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                        Rabbit  ttgtgcaaatcctgaggctcatcaaacctatgaaagacggtacaaggtatactggaatccgatctctgaa
                      Platypus  tcgtgcagatcctcaggctcgtccagcccggaaaacacagctccaggcaccccgggatccgctccctgaa
                GreenSeaTurtle  tcgtgcagatcctgagactcatcagacccatgaaagacggtacaagatatactggaattcgatctttgaa
                         Horse  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
               ChinesePangolin  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtacactggaatacgatctctgaa
                         Human  ttgtgcaaatcctgagactcatcaaacctatgaaagacggtacaaggtatactggaatccgatctctgaa
                      Aardvark  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                     zebrafish  tcttacagatatctcggctgat---gcccgttaaggacggaggaagacacc---gaatacgatccctgaa
                     BlueWhale  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
       CommonBottlenoseDolphin  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                   BelugaWhale  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                           Pig  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                FloridaManatee  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                       Tuatara  ttgtgcatatcttgagactcatcaaacccatgaaagatgg---------tactggaattcgatctttgaa
           GreaterHorseshoeBat  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
       WesternEuropeanHedgehog  ttgtgcaaatcctgagactcatcaagcccatgaaagacggtacaaggtatactgggatccggtctctgaa
                       chicken  ttgtgcagatcctgagactcattaagcccatgaaagacggtacaagatatactggaattcgatctttgaa
                  MonkParakeet  ttgtgcagatcctgagacttattaaacccatgaaagacggtacaagatatactggaattcgatctttgaa
                    HouseMouse  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
              ChineseTreeShrew  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                    RockPigeon  ttgtgcagatcctgagacttattaaacccatgaaagacggcacaagatatacgggaattcgatctttgaa
            TropicalClawedFrog  ttgtgcagatctcgagactcattaagcctttgaaagatggtacaagatacactggaatccgctcactaaa
                        Alpaca  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
             WildBactrianCamel  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                  ArabianCamel  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                           Dog  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaagatatactggaatccgatctctgaa
                    MinkeWhale  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                   KillerWhale  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                    SpermWhale  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                ChacoanPeccary  ttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgatctctgaa
                    Coelacanth  ctctagaggcggtgaggctcctt---catttgaaagatggaatcaaacggatgaaaagtcggactttgaa

     Oar_rambouillet_v1_0_addY  acttgacatgaa----------------------------------------------------------
                        Rabbit  acttgacatgaa----------------------------------------------------------
                      Platypus  actccacgtgcagcccacccgcacggcaggggccggggccgggaccgggaccgggggcgggggcggggcc
                GreenSeaTurtle  acttgacatgaa----------------------------------------------------------
                         Horse  acttgacatgaa----------------------------------------------------------
               ChinesePangolin  acttgacatgaa----------------------------------------------------------
                         Human  acttgacatgaa----------------------------------------------------------
                      Aardvark  acttgacatgaa----------------------------------------------------------
                     zebrafish  aatcgacgtgaa----------------------------------------------------------
                     BlueWhale  acttgacatgaa----------------------------------------------------------
       CommonBottlenoseDolphin  acttgacatgaa----------------------------------------------------------
                   BelugaWhale  acttgacatgaa----------------------------------------------------------
                           Pig  acttgacatgaa----------------------------------------------------------
                FloridaManatee  acttgacatgaa----------------------------------------------------------
                       Tuatara  acttgacatgaa----------------------------------------------------------
           GreaterHorseshoeBat  acttgacatgaa----------------------------------------------------------
       WesternEuropeanHedgehog  acttgacatgag----------------------------------------------------------
                       chicken  acttgacatgaa----------------------------------------------------------
                  MonkParakeet  acttgacatgaa----------------------------------------------------------
                    HouseMouse  acttgacatgag----------------------------------------------------------
              ChineseTreeShrew  acttgacatgaa----------------------------------------------------------
                    RockPigeon  acttgacatgaa----------------------------------------------------------
            TropicalClawedFrog  acttgaaatgaa----------------------------------------------------------
                        Alpaca  acttgacatgaa----------------------------------------------------------
             WildBactrianCamel  acttgacatgaa----------------------------------------------------------
                  ArabianCamel  acttgacatgaa----------------------------------------------------------
                           Dog  acttgacatgaa----------------------------------------------------------
                    MinkeWhale  acttgacatgaa----------------------------------------------------------
                   KillerWhale  acttgacatgaa----------------------------------------------------------
                    SpermWhale  acttgacatgaa----------------------------------------------------------
                ChacoanPeccary  acttgacatgaa----------------------------------------------------------
                    Coelacanth  agttgaaatgaa----------------------------------------------------------

     Oar_rambouillet_v1_0_addY  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaactggctcaaacaac
                        Rabbit  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                      Platypus  gggcccgggcccgggggcatctggcacagcatcgacgtgaagacggtgctgcagaactggctcaaacagc
                GreenSeaTurtle  ---cccaggcac--tggtatttggcagagtattgatgtgaagacagtgttacaaaattggctcaaacaac
                         Horse  ---cccaggcgc--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacagc
               ChinesePangolin  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                         Human  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                      Aardvark  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                     zebrafish  ---cgcaggagt--cacgtcttggcagagtatagacgtaaagcaggtgctcacggtgtggttaaaacaac
                     BlueWhale  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
       CommonBottlenoseDolphin  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                   BelugaWhale  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                           Pig  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                FloridaManatee  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                       Tuatara  ---cccaggcac--tggtatttggaagagttttgatgtgaagacggtgttgcaaaattggctcaaacaac
           GreaterHorseshoeBat  ---cccaggcac--tggtatttggcagagcattgacgtgaagacagtgttgcaaaattggctcaaacaac
       WesternEuropeanHedgehog  ---cccaggcac--tggtatctggcagagcattgatgtgaagactgtgttgcagaattggctcaaacaac
                       chicken  ---cccaggcac--tggtatctggcagagtattgatgtgaagacagtgctgcaaaattggctcaaacagc
                  MonkParakeet  ---ccccggcac--tggtatttggcagagtattgatgtgaagacagtgttgcaaaactggctcaaacagc
                    HouseMouse  ---cccaggcac--tggtatttggcagagtattgatgtgaagacagtgttgcaaaattggctcaaacagc
              ChineseTreeShrew  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                    RockPigeon  ---cccaggcac--tggtatttggcagagtatcgatgtgaagacagtgttacaaaattggctcaaacagc
            TropicalClawedFrog  ---tccaggttc--tggaacttggcagagcatagatgtgaaaactgtactgcaaaattggctgaggcaac
                        Alpaca  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
             WildBactrianCamel  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                  ArabianCamel  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                           Dog  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacagc
                    MinkeWhale  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                   KillerWhale  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                    SpermWhale  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                ChacoanPeccary  ---cccaggcac--tggtatttggcagagcattgatgtgaagacagtgttgcaaaattggctcaaacaac
                    Coelacanth  ---ctccagcat--cggcggatggcagagtgtagatgtcaaagctgctctgctgaactggattcagcaac

     Oar_rambouillet_v1_0_addY  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                        Rabbit  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                      Platypus  ccgagtccgacctgggcatcgagataaaggctctggacgagagtggacacaacctggctgtcaccttcac
                GreenSeaTurtle  ctgaatccaacttaggcattgaaatcaaagcttttgatgagaatggacgagatcttgctgtaactttccc
                         Horse  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
               ChinesePangolin  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                         Human  ctgaatccaacttaggcattgaaataaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                      Aardvark  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcataatcttgctgtaaccttccc
                     zebrafish  cggagaccaaccgaggcatcgagattaacgcatatgacgcgaagggaaacgacttggccgtcacttcaac
                     BlueWhale  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
       CommonBottlenoseDolphin  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatgggcatgatcttgctgtaaccttccc
                   BelugaWhale  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatcttgctgtaaccttccc
                           Pig  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                FloridaManatee  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcataatctggctgtaaccttccc
                       Tuatara  ctgaatcctacttaggcattgaaattaaagcattggatgaaaatggacgagatcttgcagtaactttccc
           GreaterHorseshoeBat  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
       WesternEuropeanHedgehog  ctgagtccaacttgggcattgaaatcaaagctttagatgaggatggccatgatcttgcagtcaccttccc
                       chicken  ctgaatccaatttaggcatcgaaataaaagcttttgatgagactggacgagatcttgctgtcacattccc
                  MonkParakeet  cggaatccaatttaggcatcgaaataaaagcctttgatgagaatggacaagaccttgctgtaactttccc
                    HouseMouse  ctgaatccaacttaggcattgaaatcaaagctttggatgagaatggccatgatcttgctgtaaccttccc
              ChineseTreeShrew  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgaccttgcggtaaccttccc
                    RockPigeon  ctgaatccaatttaggcatcgaaataaaagcttttgatgagaatggacgagatcttgctgtaactttccc
            TropicalClawedFrog  ccgaatccaatctaggcattgaaataagagcatttgatggaaatgggcaggatcttgcagta--------
                        Alpaca  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
             WildBactrianCamel  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                  ArabianCamel  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                           Dog  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgcggtaaccttccc
                    MinkeWhale  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                   KillerWhale  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatgggcatgatcttgctgtaaccttccc
                    SpermWhale  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                ChacoanPeccary  ctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatcttgctgtaaccttccc
                    Coelacanth  ctgaatcaaaatttggcatggagatcttggcaagtgattccagtggacgtgatctagctattaccttccc

     Oar_rambouillet_v1_0_addY  agaaccagga--gaagaaggactggtaagtgattactgaaaataa
                        Rabbit  aggaccagga--gaagatgggctggtaagtgataactgaaaagaa
                      Platypus  aggcccggga--gaggaggggctggtaagtg--------------
                GreenSeaTurtle  aggaccaggt--gaagatggactggtaagt---------------
                         Horse  aagaccagga--gaagatgggctggtaagtgataaatgaaaataa
               ChinesePangolin  aggaccagga--gaagatgggctggtaagtgataactgaaaataa
                         Human  aggaccagga--gaagatgggctggtaagtgataactgaaaataa
                      Aardvark  aggaccagga--gaagatgggctggtaagtgataactaaaagtaa
                     zebrafish  cgagactggg--gaggatggactggtgagt---------------
                     BlueWhale  aggaccagga--gaagatgggctggtaagtgattactgaaaataa
       CommonBottlenoseDolphin  aggaccagga--gaagatgggctggtaagtgattactgaaaataa
                   BelugaWhale  aggaccagga--gaagatgggctggtaagtgattactgaaaataa
                           Pig  aggaccagga--gaagatgggctggtaagagtttactgaaaataa
                FloridaManatee  agggccagga--gaagatgggctggtaagtgataactgaaaataa
                       Tuatara  aggacccggg--gaagatggactggtaagt---------------
           GreaterHorseshoeBat  aggaccagga--gaagatgggctggtaagtgataactgaaaatca
       WesternEuropeanHedgehog  cggaccagga--gaagatgggctggtaagtggtcaccgaaaatat
                       chicken  aggaccgggt--gaagatggattggtaagt---------------
                  MonkParakeet  aagatcaggt--gaagatggattggtaagt---------------
                    HouseMouse  aggaccagga--gaagatgggctggtaagtgataactgaaaataa
              ChineseTreeShrew  aggaccagga--gaagatgggctggtaagtgataactgaaaataa
                    RockPigeon  aggaccagga--gaagatggattggtaagt---------------
            TropicalClawedFrog  ---accagtaatgaagatggtctggtaggtcttacatgtaaata-
                        Alpaca  aggaccagga--gaagatggtttggtaagtgataactgaaaataa
             WildBactrianCamel  aggaccagga--gaagatggtttggtaagtgataactgaaaataa
                  ArabianCamel  aggaccagga--gaagatggtttggtaagtgataactgaaaataa
                           Dog  aggacccgga--gaagatgggctggtaagtgataactgaaaataa
                    MinkeWhale  aggaccagga--gaagatgggctggtaagtgattactgaaaataa
                   KillerWhale  aggaccagga--gaagatgggctggtaagtgattactgaaaataa
                    SpermWhale  aggaccagga--gaagatgggctggtaagtaattactgaaaataa
                ChacoanPeccary  aggaccaggg--gaagatgggctggtaagagtttactgaaaataa
                    Coelacanth  aggaccagga--gaagaaggactagtaagta--------------

Alignment block 48 of 177 in window, 129061967 - 129062013, 47 bps 
B D  Oar_rambouillet_v1_0_addY  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                 JavaMouseDeer  ttctaatgcaagtggaaggaaaacccaaatgttgcttctttaagttt
                         Bongo  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                         Saiga  -tctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                         Gayal  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                    LesserKudu  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                     Sitatunga  ttctaacgcaagtggaaggaaaacccaagtgttgcttctttaaattt
                 MountainNyala  ttctaacgcaagtggaaggaaaacccaagtgttgcttctttaaattt
               LesserMouseDeer  ttctaatgcaagtggaaggaaaacccaaatgttgcttctttaagttt
                AlpineMuskDeer  ttctaatgcaagtggaaggaaaacccaaatgttgcttctttcaattt
                WesternRoeDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttc
                          Gaur  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                 AmericanBison  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                       WildYak  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                   DomesticYak  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                  WaterBuffalo  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcaattt
                AfricanBuffalo  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcaattt
                   CommonEland  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                   GreaterKudu  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                      Bushbuck  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
                        Impala  ttctagcggaagtggaagaaaaacccaaatgttgcttctttaaattt
                          Suni  ttctagcggaagtggaagaaaaacccaaatgttgcttctttaaattt
                  Klipspringer  ttctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                 RoyalAntelope  ttctagcggaagtacaagaaaaacccaaatgttgcttctttaaattt
                   KirksDikDik  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                      Steenbok  ttctagcagaagtgcaagaaacacccaaatgttgcttctttaaattt
            PrzewalskisGazelle  ttctagcggaggtgcaagaaaaacccaaatgttgcttctttaaattt
                         Oribi  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
               ThomsonsGazelle  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                 GrantsGazelle  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                       Gerenuk  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                     Springbok  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                MaxwellsDuiker  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                 HarveysDuiker  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                  CommonDuiker  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                 BohorReedbuck  ttctagcggaagtggaagaaaaacccaaatgttgcttctttcaattt
              DefassaWaterbuck  ttctagcggaagtggaagaaaaacccaaatgttgcttctttcaattt
                        Lechwe  ttctagcggaagtggaagaaaaacccaaatgttgcttctttcaattt
                       Gemsbok  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
            ScimitarHornedOryx  ttctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                  RoanAntelope  ttctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                 SableAntelope  ttctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                BlueWildebeest  -tctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                          Topi  -tctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                        Herola  -tctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
               TibetanAntelope  ttctagcggaagtgcaagaaaaacccaaatgttgcttctttaaattt
                  MountainGoat  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
               EuropeanMouflon  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                AsiaticMouflon  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                     SnowSheep  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                  BighornSheep  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                  BarbarySheep  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                        Bharal  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                   NilgiriTahr  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
B D                       ARS1  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                      WildGoat  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
                  SiberianIbex  ttctagcagaagtgcaagaaaaacccaaatgttgcttctttaaattt
         ChineseForestMuskDeer  ttctaatgcaagtggaaggaaaacccaaatgttgcttctttcaattt
                  BlackMuntjac  ttctaaggcaagtggaaggaaaacccaaatgttgcttctttcaattt
                 IndianMuntjac  ttctaaggcaagtggaaggaaaacccaaatgttgcttctttcaattt
                 ReevesMuntjac  ttctaaggcaagtggaaggaaaacccaaatgttgcttctttcaattt
                PereDavidsDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcaattt
               WhiteLippedDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                   YarkandDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                       RedDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                       HogDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
               WhiteTailedDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                      MuleDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                      Reindeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                EasternRoeDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttc
                   EurasianElk  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
              ChineseWaterDeer  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcagttt
                       Giraffe  ttctaacgcaagtggaaggaaaacccaaatgttgcttcttccaattt
                     Pronghorn  ttctaactcaagtggaaggaaaacccaaatgttgcttctttcaattt
                        Cattle  ttctaacgcaagtggaaggaaaacccaaatgttgtttctttaaattt
                    ZebuCattle  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttaaattt
              SiberianMuskDeer  ttctaatgcaagtggaaggaaaacccaaatgttgcttctttcaattt
                         Okapi  ttctaacgcaagtggaaggaaaacccaaatgttgcttctttcaattt

Alignment block 49 of 177 in window, 129062014 - 129062087, 74 bps 
B D  Oar_rambouillet_v1_0_addY  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 JavaMouseDeer  agctctaaaatacaatacaataaagtagtaaaggcccaactgtggatatatttgagacccgtgaagactc
                         Bongo  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                         Saiga  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                         Gayal  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
                    LesserKudu  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                     Sitatunga  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 MountainNyala  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
               LesserMouseDeer  agctctaaaatacaatacaataaagtagtaaaggcccaactgtggatatatttgagacccgtgaagactc
                AlpineMuskDeer  agctctaagatacaatacaataaagtagtgaaggcccaactgtggatatatctgagacctgtccagactc
                WesternRoeDeer  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                          Gaur  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
                 AmericanBison  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
                       WildYak  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
                   DomesticYak  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
                  WaterBuffalo  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                AfricanBuffalo  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                   CommonEland  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                   GreaterKudu  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                      Bushbuck  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                        Impala  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                          Suni  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagatctgtcaagactc
                  Klipspringer  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 RoyalAntelope  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagatctgtcaagactc
                   KirksDikDik  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                      Steenbok  aactctaagatacaacacaataaagtagtaaaggcccaattgtggatctatctgagacctgtcaagactc
            PrzewalskisGazelle  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                         Oribi  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
               ThomsonsGazelle  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                 GrantsGazelle  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                       Gerenuk  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                     Springbok  aactctaagatacaacacaataaagtagtaaaggcccaactgtggatctatctgagacctgtcaagactc
                MaxwellsDuiker  agctctaagatacaacacaataaagtggtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 HarveysDuiker  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                  CommonDuiker  agctctaagatacaacacaataaagtaataaaggcccaactgtggatatatctgagacctgtcaagactc
                 BohorReedbuck  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
              DefassaWaterbuck  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                        Lechwe  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                       Gemsbok  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
            ScimitarHornedOryx  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                  RoanAntelope  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 SableAntelope  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                BlueWildebeest  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                          Topi  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                        Herola  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
               TibetanAntelope  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                  MountainGoat  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
               EuropeanMouflon  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                AsiaticMouflon  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                     SnowSheep  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                  BighornSheep  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                  BarbarySheep  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                        Bharal  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                   NilgiriTahr  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
B D                       ARS1  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                      WildGoat  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                  SiberianIbex  agctctaagatacaacacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
         ChineseForestMuskDeer  agctctaagatacaatacaataaagtagtgaaggcccaactgtggatatatctgagacctgtccagactc
                  BlackMuntjac  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 IndianMuntjac  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                 ReevesMuntjac  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                PereDavidsDeer  agctctaagatacaatacaataaagtcgtaaaggcccaactgtggatatatctgagacctgtcaagactc
               WhiteLippedDeer  agctctaagatacaatacaataaagtcgtaaaggcccaactgtggatatatctgagacctgtcaagactc
                   YarkandDeer  agctctaagatacaatacaataaagtcgtaaaggcccaactgtggatatatctgagacctgtcaagactc
                       RedDeer  agctctaagatacaatacaataaagtcgtaaaggcccaactgtggatatatctgagacctgtcaagactc
                       HogDeer  agctctaagatacaatacaataaagtcgtaaaggcccaactgtggatatatctgagacctgtcaagactc
               WhiteTailedDeer  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                      MuleDeer  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                      Reindeer  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                EasternRoeDeer  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                   EurasianElk  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
              ChineseWaterDeer  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                       Giraffe  agctctaagatacaatacaataaagtagtaaaggcccaactgtggatatatctgagacctgtcaagactc
                     Pronghorn  agctctaagatacaatacaataaagtagtaaaggcccagctgtggatatatctgagacctgtcaagactc
                        Cattle  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
                    ZebuCattle  agctctaagatacaatacaataaactagtaaaggcccaactgtggatatatctgaggcctgtcaagactc
              SiberianMuskDeer  agctctaagatacaatacaataaagtagtgaaggcccaactgtggatatatctgagacctgtccagactc

     Oar_rambouillet_v1_0_addY  ctac
                 JavaMouseDeer  ctac
                         Bongo  ctac
                         Saiga  ctac
                         Gayal  ctgc
                    LesserKudu  ctac
                     Sitatunga  ctac
                 MountainNyala  ctac
               LesserMouseDeer  ctac
                AlpineMuskDeer  ctac
                WesternRoeDeer  ctac
                          Gaur  ctgc
                 AmericanBison  ctgc
                       WildYak  ctgc
                   DomesticYak  ctgc
                  WaterBuffalo  ctgc
                AfricanBuffalo  ctgc
                   CommonEland  ctac
                   GreaterKudu  ctac
                      Bushbuck  ctac
                        Impala  ctac
                          Suni  ctac
                  Klipspringer  ctac
                 RoyalAntelope  ctac
                   KirksDikDik  ctac
                      Steenbok  ctac
            PrzewalskisGazelle  ctac
                         Oribi  ctac
               ThomsonsGazelle  ctac
                 GrantsGazelle  ctac
                       Gerenuk  ctac
                     Springbok  ctac
                MaxwellsDuiker  ctac
                 HarveysDuiker  ctac
                  CommonDuiker  ctac
                 BohorReedbuck  ctac
              DefassaWaterbuck  ctac
                        Lechwe  ctac
                       Gemsbok  ctac
            ScimitarHornedOryx  ctac
                  RoanAntelope  ctac
                 SableAntelope  ctac
                BlueWildebeest  ctac
                          Topi  ctac
                        Herola  ctac
               TibetanAntelope  ctac
                  MountainGoat  ctac
               EuropeanMouflon  ctac
                AsiaticMouflon  ctac
                     SnowSheep  ctac
                  BighornSheep  ctac
                  BarbarySheep  ctac
                        Bharal  ctac
                   NilgiriTahr  ctac
                          ARS1  ctac
                      WildGoat  ctac
                  SiberianIbex  ctac
         ChineseForestMuskDeer  ctac
                  BlackMuntjac  ctac
                 IndianMuntjac  ctac
                 ReevesMuntjac  ctac
                PereDavidsDeer  ctac
               WhiteLippedDeer  ctac
                   YarkandDeer  ctac
                       RedDeer  ctac
                       HogDeer  ctac
               WhiteTailedDeer  ctac
                      MuleDeer  ctac
                      Reindeer  ctac
                EasternRoeDeer  ctac
                   EurasianElk  ctac
              ChineseWaterDeer  ctac
                       Giraffe  ctac
                     Pronghorn  ctac
                        Cattle  ctgc
                    ZebuCattle  ctgc
              SiberianMuskDeer  ctac

Alignment block 50 of 177 in window, 129062088 - 129062088, 1 bps 
B D  Oar_rambouillet_v1_0_addY  a
                 JavaMouseDeer  g
                         Bongo  g
                         Saiga  g
                         Gayal  g
                    LesserKudu  g
                     Sitatunga  g
                 MountainNyala  g
               LesserMouseDeer  g
                AlpineMuskDeer  g
                WesternRoeDeer  g
                          Gaur  g
                 AmericanBison  g
                       WildYak  g
                   DomesticYak  g
                  WaterBuffalo  g
                AfricanBuffalo  g
                   CommonEland  g
                   GreaterKudu  g
                      Bushbuck  g
                        Impala  g
                  Klipspringer  g
                 RoyalAntelope  g
                   KirksDikDik  g
                      Steenbok  g
            PrzewalskisGazelle  g
                         Oribi  g
               ThomsonsGazelle  g
                 GrantsGazelle  g
                       Gerenuk  g
                     Springbok  g
                MaxwellsDuiker  g
                 HarveysDuiker  g
                  CommonDuiker  g
                 BohorReedbuck  g
              DefassaWaterbuck  g
                        Lechwe  g
                       Gemsbok  a
            ScimitarHornedOryx  a
                  RoanAntelope  a
                 SableAntelope  a
                BlueWildebeest  a
                          Topi  a
                        Herola  a
               TibetanAntelope  a
                  MountainGoat  a
               EuropeanMouflon  a
                AsiaticMouflon  a
                     SnowSheep  a
                  BighornSheep  a
                  BarbarySheep  a
                        Bharal  a
                   NilgiriTahr  a
B D                       ARS1  a
                      WildGoat  a
                  SiberianIbex  a
         ChineseForestMuskDeer  g
                  BlackMuntjac  g
                 IndianMuntjac  g
                 ReevesMuntjac  g
                PereDavidsDeer  g
               WhiteLippedDeer  g
                   YarkandDeer  g
                       RedDeer  g
                       HogDeer  g
               WhiteTailedDeer  g
                      MuleDeer  s
                      Reindeer  g
                EasternRoeDeer  g
                   EurasianElk  g
              ChineseWaterDeer  g
                       Giraffe  g
                     Pronghorn  g
                        Cattle  g
                    ZebuCattle  g
              SiberianMuskDeer  g

Alignment block 51 of 177 in window, 129062089 - 129062398, 310 bps 
B D  Oar_rambouillet_v1_0_addY  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 JavaMouseDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                         Bongo  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                         Saiga  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                         Gayal  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                    LesserKudu  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                     Sitatunga  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 MountainNyala  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
               LesserMouseDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                AlpineMuskDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                WesternRoeDeer  acagtgtttgtgcaaatcctgaggctcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                          Gaur  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 AmericanBison  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                       WildYak  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   DomesticYak  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  WaterBuffalo  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                AfricanBuffalo  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   CommonEland  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   GreaterKudu  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                      Bushbuck  accgtgtttgcgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                        Impala  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                          Suni  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  Klipspringer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 RoyalAntelope  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   KirksDikDik  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                      Steenbok  acagtgtttgtgcaaatcctgagactcatcaaacccatggaagacggtacaaggtatactggaatccgat
            PrzewalskisGazelle  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                         Oribi  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
               ThomsonsGazelle  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 GrantsGazelle  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                       Gerenuk  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                     Springbok  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                MaxwellsDuiker  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 HarveysDuiker  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  CommonDuiker  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 BohorReedbuck  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
              DefassaWaterbuck  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                        Lechwe  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                       Gemsbok  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
            ScimitarHornedOryx  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  RoanAntelope  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 SableAntelope  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                BlueWildebeest  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                          Topi  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                        Herola  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
               TibetanAntelope  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  MountainGoat  acagtgtttgtgcaaatcctgagacttataaaacccatgaaagacggtacaaggtatactggaatccgat
               EuropeanMouflon  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                AsiaticMouflon  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                     SnowSheep  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  BighornSheep  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  BarbarySheep  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                        Bharal  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   NilgiriTahr  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
B D                       ARS1  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                      WildGoat  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  SiberianIbex  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
         ChineseForestMuskDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                  BlackMuntjac  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 IndianMuntjac  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                 ReevesMuntjac  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                PereDavidsDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
               WhiteLippedDeer  acggtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   YarkandDeer  acggtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                       RedDeer  acggtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                       HogDeer  acggtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
               WhiteTailedDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                      MuleDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                      Reindeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                EasternRoeDeer  acagtgtttgtgcaaatcctgaggctcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                   EurasianElk  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
              ChineseWaterDeer  acagtgtttgtgcaaatcctgaggctcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                       Giraffe  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                     Pronghorn  acagtgtttgtacaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                        Cattle  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
                    ZebuCattle  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat
              SiberianMuskDeer  acagtgtttgtgcaaatcctgagactcatcaaacccatgaaagacggtacaaggtatactggaatccgat

     Oar_rambouillet_v1_0_addY  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 JavaMouseDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                         Bongo  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                         Saiga  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                         Gayal  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
                    LesserKudu  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                     Sitatunga  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 MountainNyala  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
               LesserMouseDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                AlpineMuskDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                WesternRoeDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                          Gaur  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
                 AmericanBison  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
                       WildYak  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
                   DomesticYak  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
                  WaterBuffalo  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                AfricanBuffalo  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                   CommonEland  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                   GreaterKudu  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                      Bushbuck  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                        Impala  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                          Suni  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  Klipspringer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 RoyalAntelope  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                   KirksDikDik  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                      Steenbok  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
            PrzewalskisGazelle  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                         Oribi  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcacaa
               ThomsonsGazelle  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 GrantsGazelle  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                       Gerenuk  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                     Springbok  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                MaxwellsDuiker  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 HarveysDuiker  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  CommonDuiker  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 BohorReedbuck  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
              DefassaWaterbuck  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                        Lechwe  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                       Gemsbok  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
            ScimitarHornedOryx  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  RoanAntelope  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                 SableAntelope  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                BlueWildebeest  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                          Topi  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                        Herola  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
               TibetanAntelope  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  MountainGoat  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtattgcaaaa
               EuropeanMouflon  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                AsiaticMouflon  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                     SnowSheep  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  BighornSheep  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  BarbarySheep  ctctgaaacttgacatgagcccaggcactggtatttggcagagcatcgatgtgaagacagtgttgcaaaa
                        Bharal  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                   NilgiriTahr  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                          ARS1  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                      WildGoat  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  SiberianIbex  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
         ChineseForestMuskDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                  BlackMuntjac  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                 IndianMuntjac  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                 ReevesMuntjac  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                PereDavidsDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
               WhiteLippedDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                   YarkandDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                       RedDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                       HogDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
               WhiteTailedDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                      MuleDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                      Reindeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                EasternRoeDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                   EurasianElk  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
              ChineseWaterDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgacgtgaagacagtgttgcaaaa
                       Giraffe  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                     Pronghorn  ctctgaagcttgacatgaacccaggcgctggtatttggcagagcattgatgtgaagacagtgttgcaaaa
                        Cattle  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
                    ZebuCattle  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcagaa
              SiberianMuskDeer  ctctgaaacttgacatgaacccaggcactggtatttggcagagcattgatgtgaagacagtgttgcaaaa

     Oar_rambouillet_v1_0_addY  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                 JavaMouseDeer  ttggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaacggtcatgatctt
                         Bongo  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
                         Saiga  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                         Gayal  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                    LesserKudu  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
                     Sitatunga  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
                 MountainNyala  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
               LesserMouseDeer  ttggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaacggtcatgatctt
                AlpineMuskDeer  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                WesternRoeDeer  ctggctcaaacaacctgaatccaacttaggcatcgagatcaaagctttagatgagaatggccatgatctt
                          Gaur  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                 AmericanBison  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                       WildYak  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                   DomesticYak  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                  WaterBuffalo  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                AfricanBuffalo  ctggctcaaacaacctgaatccaacttaggcattgaaattaaagctttagatgagaatggtcatgatctt
                   CommonEland  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
                   GreaterKudu  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
                      Bushbuck  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcgtgatctc
                        Impala  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcataatctt
                          Suni  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcataatctt
                  Klipspringer  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                 RoyalAntelope  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                   KirksDikDik  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                      Steenbok  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
            PrzewalskisGazelle  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                         Oribi  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
               ThomsonsGazelle  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                 GrantsGazelle  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                       Gerenuk  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                     Springbok  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                MaxwellsDuiker  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                 HarveysDuiker  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctc
                  CommonDuiker  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                 BohorReedbuck  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
              DefassaWaterbuck  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                        Lechwe  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                       Gemsbok  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
            ScimitarHornedOryx  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                  RoanAntelope  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                 SableAntelope  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                BlueWildebeest  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                          Topi  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                        Herola  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
               TibetanAntelope  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                  MountainGoat  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
               EuropeanMouflon  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                AsiaticMouflon  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                     SnowSheep  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                  BighornSheep  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                  BarbarySheep  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttggatgagaatggtcatgatctt
                        Bharal  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                   NilgiriTahr  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                          ARS1  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                      WildGoat  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                  SiberianIbex  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
         ChineseForestMuskDeer  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                  BlackMuntjac  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
                 IndianMuntjac  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
                 ReevesMuntjac  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
                PereDavidsDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
               WhiteLippedDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
                   YarkandDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
                       RedDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
                       HogDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
               WhiteTailedDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccacgatctt
                      MuleDeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccacgatctt
                      Reindeer  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccacgatctt
                EasternRoeDeer  ctggctcaaacaacctgaatccaacttaggcatcgagatcaaagctttagatgagaatggccatgatctt
                   EurasianElk  ctggctcaaacaacctgaatccaacttaggcattgagatcaaagctttagatgagaatggccatgatctt
              ChineseWaterDeer  ctggctcaaacaacctgaatccaacttaggcatcgagatcaaagctttagatgagaatggccatgatctt
                       Giraffe  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt
                     Pronghorn  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                        Cattle  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
                    ZebuCattle  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggccatgatctt
              SiberianMuskDeer  ctggctcaaacaacctgaatccaacttaggcattgaaatcaaagctttagatgagaatggtcatgatctt

     Oar_rambouillet_v1_0_addY  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                 JavaMouseDeer  gctgtaaccttcccagaaccaggagaagatgggctggtaagtgatccctgacaataacatgctaaaaccc
                         Bongo  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                         Saiga  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                         Gayal  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                    LesserKudu  gctgtaaccttcccagaaccaggagaagatggactggtaagtaattactgaaaataacatgctaaaaacc
                     Sitatunga  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                 MountainNyala  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
               LesserMouseDeer  gctgtaaccttcccagaaccaggagaagatgggctggtaagtgatccctgacaataacatgctaaaaccc
                AlpineMuskDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                WesternRoeDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                          Gaur  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                 AmericanBison  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                       WildYak  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                   DomesticYak  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                  WaterBuffalo  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                AfricanBuffalo  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                   CommonEland  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                   GreaterKudu  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattattgaaaataacatgctaaaaacc
                      Bushbuck  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                        Impala  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaacaacgtgctaaaaacc
                          Suni  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                  Klipspringer  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                 RoyalAntelope  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                   KirksDikDik  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                      Steenbok  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
            PrzewalskisGazelle  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                         Oribi  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacacgctaaaaacc
               ThomsonsGazelle  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                 GrantsGazelle  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                       Gerenuk  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                     Springbok  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                MaxwellsDuiker  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                 HarveysDuiker  gctgtaacctttccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                  CommonDuiker  gctgtaacctttccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                 BohorReedbuck  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
              DefassaWaterbuck  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                        Lechwe  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                       Gemsbok  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgagaataacatgctaaaaacc
            ScimitarHornedOryx  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgagaataacatgctaaaaacc
                  RoanAntelope  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgagaataacatgctaaaaacc
                 SableAntelope  gctgtaaccttcccagaaccaggagaagaaggactggtgagtgattactgagaataacatgctaaaaacc
                BlueWildebeest  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgccaaaaacc
                          Topi  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgccaaaaacc
                        Herola  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgccaaaaacc
               TibetanAntelope  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                  MountainGoat  gctgtaaccttcccagagccaggagaagaaggactggtaagtgactattgaaaataacatgctaaaaacc
               EuropeanMouflon  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                AsiaticMouflon  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                     SnowSheep  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                  BighornSheep  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                  BarbarySheep  gctgtaaccttcccagaaccaggggaagaaggactggtaagtgattgctgaaaataacatgctaaaaacc
                        Bharal  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                   NilgiriTahr  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                          ARS1  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                      WildGoat  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
                  SiberianIbex  gctgtaaccttcccagaaccaggagaagaaggactggtaagtgattactgaaaataacatgctaaaaacc
         ChineseForestMuskDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                  BlackMuntjac  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                 IndianMuntjac  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacattctaaaaacc
                 ReevesMuntjac  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                PereDavidsDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaagcc
               WhiteLippedDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaagcc
                   YarkandDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaagcc
                       RedDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaagcc
                       HogDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaactaacatgctaaaagcc
               WhiteTailedDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagt-attactgaaaataacatgctaaaaacc
                      MuleDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagt-attactgaaaataacatgctaaaaacc
                      Reindeer  gctgtaaccttcccagaaccaggagaagatggactggtaagt-attactgaaaataacatgctaaaaacc
                EasternRoeDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                   EurasianElk  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
              ChineseWaterDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                       Giraffe  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatactaaaaacc
                     Pronghorn  gctgtaaccttcccagaaccaggagaagatggactggtaagtgagtactgaaaataacatgctaaaaccc
                        Cattle  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
                    ZebuCattle  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc
              SiberianMuskDeer  gctgtaaccttcccagaaccaggagaagatggactggtaagtgattactgaaaataacatgctaaaaacc

     Oar_rambouillet_v1_0_addY  ttgtgatgtgtttattcataatgtgaatga
                 JavaMouseDeer  ttgctgtgtatttattcacaatgtgaatga
                         Bongo  ttgttatgtatttattcacaaggtgaatga
                         Saiga  ttgttatgtatttattcataatgtgaatga
                         Gayal  ttgttatgtgtttattcataatgtgaatga
                    LesserKudu  ttgttatgtatttattcacaaggtgaatga
                     Sitatunga  ttgttatgtatttattcacaaggtgaatga
                 MountainNyala  ttgttatgtatttattcacaaggtgaatga
               LesserMouseDeer  ttgctgtgtatttattcacaatgtgaatga
                AlpineMuskDeer  ttattatgtatttattcataatgtgaatga
                WesternRoeDeer  ttgttatgtatttattcatgatgtgaatga
                          Gaur  ttgttatgtgtttattcataatgtgaatga
                 AmericanBison  ttgttatgtgtttattcataatgtgaatga
                       WildYak  ttgttatgtgtttattcataatgtgaatga
                   DomesticYak  ttgttatgtgtttattcataatgtgaatga
                  WaterBuffalo  ttgttatgtgtttactcataatgtgagtga
                AfricanBuffalo  ttgttatgtgtttacttataatgtgaatga
                   CommonEland  ttgttatgtatttattcacaaggtgaatga
                   GreaterKudu  ttgttatgtatttattcacaaggtgaatga
                      Bushbuck  ttgttctgtatttattcacaaggtgaatga
                        Impala  ttgttatgtatttattcataatgtgaatga
                          Suni  ttgttatgtatttattcataatgtgagtga
                  Klipspringer  ttgttatgtatttattcataatgtgaatga
                 RoyalAntelope  ttgttatgtatttattcataatgtgaatga
                   KirksDikDik  ttgttatgtatttattcataatgtgaatga
                      Steenbok  tcgttatgtatttattcataatgtgaatga
            PrzewalskisGazelle  ttgttacgtatttattcataatgtgaatga
                         Oribi  ttgttatgtatttattcataatgtgaatga
               ThomsonsGazelle  ttgttatgtatttattcataatgtgaatga
                 GrantsGazelle  ttgttatgtatttattcataatgtgaatga
                       Gerenuk  ttgttatatatttattcataatgtgaatga
                     Springbok  ttgttatgtatttattcataatgtgaatga
                MaxwellsDuiker  ttgttatgtatttattcataacgtgaatgg
                 HarveysDuiker  ttgttatgtatttattcataacgtgaatgg
                  CommonDuiker  ttgttatgtatttattcataacgtgaatgg
                 BohorReedbuck  ttgttatgcatttattcataatgtgaatga
              DefassaWaterbuck  ttgttatgtatttattcataatgtgaatga
                        Lechwe  ttgttatgtatttattcataatgtgaatga
                       Gemsbok  ttgttatgtatttattcataatgtgaatga
            ScimitarHornedOryx  ttgttatgtatttattcataatgtgaatga
                  RoanAntelope  ttgttatgtatttattcataatgtgaatga
                 SableAntelope  ttgttatgtatttattcataatgtgaatga
                BlueWildebeest  ttgctgtgtatttattcataatgtgaatga
                          Topi  ttgttgtgtatttattgataatgtgaatga
                        Herola  ttgttgtgtatttattgataatgtgaatga
               TibetanAntelope  ttgttatgtatttattcataatgtgaatgg
                  MountainGoat  ttgttatgtatttattcataatgtgaatga
               EuropeanMouflon  ttgtgatgtgtttattcataatgtgaatga
                AsiaticMouflon  ttgtgatgtgtttattcataatgtgaatga
                     SnowSheep  ttgtgatgtgtttattcataatgtgaatga
                  BighornSheep  ttgtgatgtgtttattcataatgtgaatga
                  BarbarySheep  ttgttatgtatttattcataatgtgaatga
                        Bharal  ttgttatgtatttattcataatgtgaatga
                   NilgiriTahr  ttgtgatgtgtttattcataatgtgaatga
                          ARS1  ttgttatgtatttattcataatgtgaatga
                      WildGoat  ttgttatgtatttattcataatgtgaatga
                  SiberianIbex  ttgttatgtatttattcataatgtgaatga
         ChineseForestMuskDeer  ttattatgtatttattcataatgtgaatga
                  BlackMuntjac  ttattatgtatttattcataatgtaaatga
                 IndianMuntjac  ttgttatgtatttattcataatgtgaatga
                 ReevesMuntjac  ttgttatgtatttattcataatgtaaatga
                PereDavidsDeer  ttgttatgtatttattcataatgtgaatga
               WhiteLippedDeer  ttgttatgtatttattcataatgtgaatga
                   YarkandDeer  ttgttatgtatttattcataatgtgaatga
                       RedDeer  ttgttatgtatttattcataatgtgaatga
                       HogDeer  ttgttatgtatttattcataatgtgaatga
               WhiteTailedDeer  ttgttatgtatttattaataatgtgaatga
                      MuleDeer  ttgttatgtatttattaataatgtgaatga
                      Reindeer  ttgttatgtatttattaataatgtgaatga
                EasternRoeDeer  ttgttatgtatttattcatgatgagaatga
                   EurasianElk  ttgttatgtatttattcataatgtgaatga
              ChineseWaterDeer  ttgttatgtatttattcatgatgttaatga
                       Giraffe  ttgttatgtatttattcataatgtgaatga
                     Pronghorn  tcgttatgtatttattcataatgcgaatga
                        Cattle  ttgttatgtgtttattcataatgtgaatga
                    ZebuCattle  ttgttatgtgtttattcataatgtgaatga
              SiberianMuskDeer  ttattatgtatttattcataatgtgaatga

Alignment block 52 of 177 in window, 129062356 - 129062886, 531 bps 
B D  Oar_rambouillet_v1_0_addY  catgctaa----aaaccttgtgatgtgtttattcataatgtgaatgaatagtagtgaaaa-ataactacc
                        Rabbit  ccctctag----taaccttgttatgtttttgttcctaatatgaatgaataaaagtgggaa-acaactacc
                         Horse  tattctaa----caaccttgttatgtttttattcatcatgtgaatgaataatagtggaaa-atcactacc
               ChinesePangolin  cattctaa----caaccttattatgtttttattcataatgtgtgtgaataatagaggcaa-ttaactacc
                         Human  cattataa----taacc---ttatgtttttattcataatatgaacaaacaatagtggaaa-atagctaca
                      Aardvark  tattctaa----caaccttattatgtttttattcgtaatgtgattgaattatactagaaa-ataaataac
                     BlueWhale  cattctaa----aaacc---ttatgtttttattcataatgtgaatgaatagtagtgaaaa-acaactacc
       CommonBottlenoseDolphin  cattctaa----aaacc---ttatgtttttattcataatgtgaatgaatagtagtggaaa-acaactacc
                   BelugaWhale  cattctaa----aaacc---ttatgtttttattcataatgtgaatgaatagtagtggaaa-acaactacc
                           Pig  cactctta----aaatcttgttatgtttttattcataatgtgaatgagtagtagtggaaa-ataactacc
                FloridaManatee  tatactaa----caatcttattatatttttattcataacatgaatgaattatgccagaaa-ataaatacc
           GreaterHorseshoeBat  cattctaa----caaccttgttatgttatca-tcataatgtgaatgaataatagtggaaa-atagccacc
       WesternEuropeanHedgehog  tgtcctaa----caaccttgttatgtttttattcagaatgcaagt--atatttgtggaaa-ataacgacc
                    HouseMouse  cattctag----caaccgtgttacatttttattcctgacatgaatga-taatagtgaaaa-agaaata-c
              ChineseTreeShrew  cattctaa----caaccttggtatggctttattcataatgtgaatgagtaatagtggaaa-ataactagc
                        Alpaca  cactctaa----aaaccttgtcatgtttttattcataatatgaatgaatagtagtggaaa-ataactacc
             WildBactrianCamel  cactctaa----aaaccttgtcatgtttttattcataatgtgaatgaatagtagtggaaa-ataactacc
                  ArabianCamel  cactctaa----aaaccttgtcatgtttttattcataatgtgaatgaatagtagtggaaa-ataactacc
                           Dog  ca-tctaaccacaaacattgtgacatttttattcatcatgtgaatg-ataatagtggaaa-atcactacc
                    MinkeWhale  cattctaa----aaacc---ttatgtttttattcataatgtgaatgaatagtagtgaaaa-acaactacc
                   KillerWhale  cattctaa----aaacc---ttatgtttttattcataatgtgaatgaatagtagtggaaa-acaactacc
                    SpermWhale  cattctaa----aaacc---ttatgtttttattcataatgtgaatgaatagtagtggaaa-acaactacc
                ChacoanPeccary  tattctaa----aaaccttgttatgtttttattcataatgtgaatgagtagtagtggaaatttaactacc

     Oar_rambouillet_v1_0_addY  agtttc------------ct-gt---gcttataagccagacaaaggtaccttaccccgatggtagccctg
                        Rabbit  gatttc------------ct-at---gctcatgagccagacaaaggtatcttactccaatggtagccctg
                         Horse  agtttc------------ct-at---gctaacaagctagacaaaggcatcttaccccaatggcagccctg
               ChinesePangolin  aatttc------------cc-at---gctcataagccagacaaaggtatcttacctcaacggtagccctg
                         Human  aattcc------------ct-aa---gctcataagctagacaaaggtatcttaccccaacggtagccctg
                      Aardvark  aatttc------------ct-tt---gctcataagccagacaaaggtatgttaccccaatggtagccctg
                     BlueWhale  agtttc------------ct-at---gctcataagccggaaaaaggtatcttatcccgatggtagccctg
       CommonBottlenoseDolphin  aatttc------------ct-at---gctcataagccggacaaaggtatcttaccccgatggtagccctg
                   BelugaWhale  aatttc------------ct-at---gctcataagccggacaaaggtatcttaccccgatggtagccctg
                           Pig  agtttc------------c------------taagctagacaaaagtatcttaccccaatggtagccctg
                FloridaManatee  aatttc------------ttaat---gctcataagccagacaaaggtatgttaccccaatggtagccctg
           GreaterHorseshoeBat  aagttc------------ct-aa---gctcataagccagacaaaggtatcttatcctaatggcagccctg
       WesternEuropeanHedgehog  caatttgctcatgctgtacc-aatgtgctgctaagtcagataaaggtatc-tgtccatgtggcatccctg
                    HouseMouse  tatttc------------ct-at---gctcataagccagacaaa-gtatcttactccaaaggtaggtgtg
              ChineseTreeShrew  aatttt------------ct-at---ggccatatgccacacaaaggtatctttctccaatggtagccctg
                        Alpaca  agtttc------------ct-at---gctcataagccagacaaaggtaacttaccccaatggtagccctg
             WildBactrianCamel  agtttc------------ct-at---gctcataagccagacaaagataacttaccccaatggtagccctg
                  ArabianCamel  agtttc------------ct-at---gctcataagccagacaaagataacttaccccaatggtagccctg
                           Dog  catctc------------ct-at---gctcagaagccagacaaaggtatcttaccccaatggtagccctg
                    MinkeWhale  agtttc------------ct-at---gctcataagccggaaaaaggtatcttaccccgatggtagccctg
                   KillerWhale  aatttc------------ct-at---gctcataagctggacaaaggtatcttaccccgatggtagccctg
                    SpermWhale  agtttc------------ct-at---gctcataagccggacaaaggtatcttaccccgatggtagccctg
                ChacoanPeccary  agttgc------------c------------taagctagacaaaggcatcttaccccaatggtagccctg

     Oar_rambouillet_v1_0_addY  tacccaataaaagta-------------ggtgt-cccatttcacaccctatgaaa-ac-----tctcttg
                        Rabbit  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaaaac-----tcccttg
                         Horse  tacccaataaaagta-------------ggtgt-ccaatttcatatccaatgaaacac-----cctcttg
               ChinesePangolin  tacccaataaa---a-------------ggtgt-ccaatttcataagccatgaaacaa-----ccacttg
                         Human  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tcccttg
                      Aardvark  tacccaataaaagta-------------ggtat-ccaatttcatatcctatgaaacac-----tcccttg
                     BlueWhale  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tctcttg
       CommonBottlenoseDolphin  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tctcttg
                   BelugaWhale  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tctcttg
                           Pig  tacccaataaaagta-------------ggtgt-tcagtttcatatcctatgaaatac-----cctcttg
                FloridaManatee  tacccaataaaagta-------------ggtat-ttaatttcataccctatgaaacac-----tcccttg
           GreaterHorseshoeBat  tacccaataaaagta-------------ggtat-ctaatttcatatcctatgaaacac-----cctcttg
       WesternEuropeanHedgehog  tacccaataaaacca-------------actct-ctaatttc-tattctatgaactac-----tcccttg
                    HouseMouse  tacccaa-aacagtacacacctacctttggtgtgtcaatctcatgtcccatgagggacatgaaccccttg
              ChineseTreeShrew  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaatac-----tcccttg
                        Alpaca  tacccaataaaagta-------------ggtgt-ctagtttcatatcctatgaaacac-----cctcatg
             WildBactrianCamel  tacccaataaaagta-------------ggtgt-ttagtttcatatcctatgaaacac-----cctcttg
                  ArabianCamel  tacccaataaaagta-------------ggtgt-ttagtttcatatcctatgaaacac-----cctcttg
                           Dog  tacccaataaaagta-------------ggtgt-ctaatttcatat-----------c-----cctcttg
                    MinkeWhale  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tctcttg
                   KillerWhale  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tctcttg
                    SpermWhale  tacccaataaaagta-------------ggtgt-ccaatttcatatcctatgaaacac-----tctcttg
                ChacoanPeccary  tacccaataaaagta-------------ggtgt-tcagtttcatatcctatgaaacac-----cttcttg

     Oar_rambouillet_v1_0_addY  atactttt-actttgcatgagga--ttta-a-aagaaaaaaagttataccatggtcctt-----------
                        Rabbit  ataccctt-cgtttgcatgagag---ttt-a-t--aaaaacaattataccatggttctt-----------
                         Horse  atatgtca-actttgcatgagga-----t-t-a--aaaaaacgttataccatagtcctt-----------
               ChinesePangolin  atactttt-actttgcatgatga-----t-taa--aaaaaaagttatgccatagtcctt-----------
                         Human  atactctt-actttgcatcaaga---ttt-t-a--gaaaacaattataccatacttctt-----------
                      Aardvark  atactcttaactttgcatgagga--tttt-t-t--tttaaaaattatacaatagtgctt-----------
                     BlueWhale  atactttt-agtttgcatgagga--ctta-a-a--gaaaaaagttacaccatagtcctt-----------
       CommonBottlenoseDolphin  atactttt-agtttgcatgagga--ctta-a-a--gaaaaaagttacaccatagtcctt-----------
                   BelugaWhale  atactttt-agtttgcatgagga--ctta-a-a--gaaaaaagttacaccatagtccct-----------
                           Pig  atactttt-actttgcatgagga--tttaga-a--gaaaaaagttttactataatcctt-----------
                FloridaManatee  atattctt-actttccatgagga-------t-a--aacaaaaattatatcatagtgctt-----------
           GreaterHorseshoeBat  atactttt-actttgcatg-aga--ttaa-------ataaaagttgtaccatagtcctt------cttag
       WesternEuropeanHedgehog  aaactttt-cctttgcatgcagatttttt-------tttaaagctatcttgtagcccttaacttcctaag
                    HouseMouse  gtgttctt-acttagcatgaaga--ccaa-------aaaccaattacatcat-gttcct-----------
              ChineseTreeShrew  ata--ctt-acctggcatgagaa-tttta-------aaaacaatcatagtatggttctt-----------
                        Alpaca  atactttt-actttgcatgagga--ttta-a-aag-aaaaaagttataacacagtcctt-----------
             WildBactrianCamel  atactttt-actttgcatgagga--ttta-a-aag-aaaaaagttgtaacacagtcctt-----------
                  ArabianCamel  atactttt-actttgcatgagga--ttta-a-aag-aaaaaagttataacacagtcctt-----------
                           Dog  atactttt-attttgcacgagga--tt------aa-aaaacagttatgccacagtcatt-----------
                    MinkeWhale  atactttt-agtttgcatgagga--ctta---aag-aaaaaagttacaccatagtcctt-----------
                   KillerWhale  atactttt-agtttgcatgagga--ctta---aag-aaaaaagttacaccatagtcctt-----------
                    SpermWhale  atactttt-agtttgcatgagga--ctta---aag-aaaaaagttacaccataatcctt-----------
                ChacoanPeccary  atactttt-actttgcatgagga--ttta-g-aag-aaaaaagttttactatagtcctt-----------

     Oar_rambouillet_v1_0_addY  ---------------------------aagtttttaaggaa-ttcttttgaattgaaattgaaatataaa
                        Rabbit  ---------------------------aacttcttaagaag-ttcttttgaattgagaatgaaatataaa
                         Horse  ---------------------------aactcctcagggag-ttctttggaattgggaatgaaatataaa
               ChinesePangolin  ---------------------------aactttttagggag-ttcttttgaattgggaatgaaatacaaa
                         Human  ---------------------------aacttcttaagaag-tccttttgaattgggaatgaaatataaa
                      Aardvark  ---------------------------aacttcttaaggta--ctctttgaattagaaatgaagcataag
                     BlueWhale  ---------------------------aacttctttaggaa-ttcttttgaattgggaatgaaatataaa
       CommonBottlenoseDolphin  ---------------------------aacttcttaaggaa-ttattttgaattgggaatgaaatataaa
                   BelugaWhale  ---------------------------aacttcttaaggaa-ttcttttgaattgggaatgaaatataaa
                           Pig  ---------------------------aa---cttaggaaa-ttcttttgaattggaaatgaaacacaaa
                FloridaManatee  ---------------------------aatttcttaaagtg-ttcttttgaatcagaaatgaaatataaa
           GreaterHorseshoeBat  gt-----------------------acaacttcttaggtag-ttcttttgaattgggaatgaaatataaa
       WesternEuropeanHedgehog  gttacttaaagctatcttgtagcccttaacttccta---ag-actatttaaaatgggaataaattgtaag
                    HouseMouse  ---------------------------aattccacaaggag-gtcctt---actaggaattagatgtaat
              ChineseTreeShrew  ---------------------------gacttcttaaagag-ttcttttgaattaggaatgaaatataaa
                        Alpaca  ---------------------------aacttctaagggaa-tttttttgaattgggaatgaaatataaa
             WildBactrianCamel  ---------------------------aacttctaagggaa-tttttttgaattgggaatgaaatataaa
                  ArabianCamel  ---------------------------aacttctaagggaattttttttgaattgggaatgaaatataaa
                           Dog  ---------------------------agcttcctagggag-ttctgtcgaattagagatgaaatatgaa
                    MinkeWhale  ---------------------------aacttctttaggaa-ttcttttgaattgggaatgaaatataaa
                   KillerWhale  ---------------------------aacttcttaaggaa-ttattttgaattgggaatgaaatataaa
                    SpermWhale  ---------------------------aacttcttcaggaa-ttcttttgaatcgggaatgaaatataaa
                ChacoanPeccary  ---------------------------a--------ggaaa-ttcttttgaattgggaatgaagcacaaa

     Oar_rambouillet_v1_0_addY  atgc-tttccattgatgtgctacttgattatataaataaaaacaggaagtcttcaca-----gtaga-tc
                        Rabbit  ctgc-ttttcattgatatgctacatgcttatatgaat-aaaatatgaactgtatata-----atgaattc
                         Horse  gtgc-ttttcattgatatgccacataattatatgaataaaaacacaaaatcttcaca-----atggattc
               ChinesePangolin  atac---ttcaatgacatgctacatgattatatgaataaaagtatgaaatttttata-----gtgaattc
                         Human  gtgc-ttttcattaatatgatacatgactgtatgtattaaaatattaactctatata-----gtggattt
                      Aardvark  gtac-tcttcattgatatgacacctaattatatgaataaaaacatgaaatcttcttg-----gtggatta
                     BlueWhale  gtgc-ttttcattgatgtgctatatgattatataaataaaaacatgaagtcttcata-----gtggattc
       CommonBottlenoseDolphin  gtgc-ttttcattgatgtgctatatgattatataaataaaaacatgaagtcttcata-----gtggattc
                   BelugaWhale  gtgc-ttttcattgatgtgctatatgattatataaataaaaacatgaagtcttcata-----gtggattc
                           Pig  ttgc-ttttcattgatatgccatatgattatatgaat-aaaacatgaaatcttcata-----ttggattc
                FloridaManatee  gtgc-ttttcattgatatgacacatgattatatgaataaaaacatgaactcttcata-----gtggatta
           GreaterHorseshoeBat  gtac-ttttcatggatatgctacatgattacatgaataaaatcatgaaatcttcata-----gtagattc
       WesternEuropeanHedgehog  gtcc-ttttcagtgacatgttagtttattatatgaagagaagcaggaactcttcata-----gt------
                    HouseMouse  gtcc-ttttcattgtaa-gtcacataattatgta---taaactatgaagtctctatgtaactgtagattc
              ChineseTreeShrew  gtgg-ttttcattgagatggtacatgattatatgaattaaaatatgaattctatataga---gtgagtgc
                        Alpaca  atgctttttcattgatatgcactacggtcatatgaataaaaacatgaaatcttcata-----gtagattc
             WildBactrianCamel  atgctttttcattgatatgcactacggtcatatgaataaaaacatgaaatcttcata-----gtagattc
                  ArabianCamel  atgctttttcattgatatgcactacggtcatatgaataaaaacatgaaatcttcata-----gtagattc
                           Dog  gtgc-ttttcattgatatgc-----------atgaataaaaacatgaaatactcatt-----gtggatcc
                    MinkeWhale  gtgc-ttttcattgatgtgctatatgattatataaataaaaacatgaagtcttcata-----gtggattc
                   KillerWhale  gtgc-ttttcattgatgtgctatatgattatataaataaaaacatgaagtcttcata-----gtggattc
                    SpermWhale  gtgc-ttttcactgatgtgctatatgattatataaataaaaacatgaaatcttcata-----gtggattc
                ChacoanPeccary  ttgc-ttttcattgatatgccatatgattatatgaat-gaaacatgaaatcttcata-----ttgtattc

     Oar_rambouillet_v1_0_addY  tagt-acaca-ctcaacaacaca-----------t-tttt-----ccc----ccagaagagtgaaatatt
                        Rabbit  cagt-tcata-ccccaaaaatcagact--tttctt-ttcc-----t-c----tccaaagggtgccaaatg
                         Horse  ttgt-acata-cccaacaaattaaacc----ttttcttcc-----c-c----ccagaagagtgtcaaatg
               ChinesePangolin  tagt-acata-cccaacaaattaaaac----tttt-tttc-----c-c----ccagaagagtgccaaatg
                         Human  tacc-acataaaccaacaaatccaaacattatttt-tttc-----t-c----ccagaagggtgccaaatg
                      Aardvark  tagt-acataccaaaccaaaccaaactggtgtcct-tcga-----c-t----ccagaa-ggtaccaaatg
                     BlueWhale  tagg-acata-cccaacaaaaca---------ttt-tttt-----c-c----ctagaagagtgccaaacg
       CommonBottlenoseDolphin  tagg-acata-cccaaaaaaaca---------ttt-tttt-----c-c----ctagaagagtgccaaagg
                   BelugaWhale  tagg-acata-cccaaaaaaaca---------ttt-tttt-----c-c----ctagaagagtgccaaagg
                           Pig  tagt-atata-cccaagtaaata----------tt-tttt-----c-c----ctagaagagtgccaagtg
                FloridaManatee  tagt-acata-ccaaacaaagcaaaactggtgttt-cccc-----a-c----ccaagagggtgacaaatg
           GreaterHorseshoeBat  tagt-atcta-tccaacagattaaaac----attt-tttc-----c-c------ccagaagagtgaaatg
       WesternEuropeanHedgehog  --gt-atata-ctaaacacattaaaat----cttt-catc-----t-c------attagaatgataaatg
                    HouseMouse  tggt-ttcta-cccaacaaattaaaac----cttt-cctt-----c-ccgttttatgtttctttcctatg
              ChineseTreeShrew  tcataaacag-ctaaacacatcagaat----tgtt-tttt-----c-c--tctcagagaggtgccaaatg
                        Alpaca  tagt-acata-ttcaacagaaca----------tt-tttt-----c-c----ctagaagagcatcaaa--
             WildBactrianCamel  tagt-acata-ttcaacaaaaca----------tt-tttt-----c-c----ctagaagagtatcaaatg
                  ArabianCamel  tagt-acata-ttcaacaaaaca----------tt-tttt-----c-c----ctagaagagtatcaaatg
                           Dog  tact-acatc-cccaacagattaaaat----ttcc-tttt-----c-t----tcagaagaatgccagatg
                    MinkeWhale  tagg-acata-cccaacaaaaca---------ttt-tttt-----c-c----ctagaagagtgccaaacg
                   KillerWhale  tagg-acata-tccaaaaaaaca---------ttt-tttt-----c-c----ctagaagagtgccaaagg
                    SpermWhale  tagg-acata-cccaacaaaaca---------ttt-tttt-----c-c----ctagaagagtaccaaaca
                ChacoanPeccary  tagt-acata-cccaagcaaaca---------ttt-ttttttttcc-c----ctagaagagtgccaagtg

     Oar_rambouillet_v1_0_addY  tgtta----aaa---ttcttttg---ctta--gtaaagcagaaaa-a---taaactcta-----------
                        Rabbit  tgttg----aca---agttctgg---cttagtataaagcaagaaa-aaacctaactttagtctgcttctt
                         Horse  tgttg----aaa--gttttct-g---ctta--ataaagca-gagt-a----aaacttta-----------
               ChinesePangolin  tcttg----aaa--tttttttgg---ctta--ataaagtgtaaaa-a----aaacttta-----------
                         Human  tgtt-----aaa--gatttttgg---ctta--gcataaaacagat-a----aacctttt-----------
                      Aardvark  tgttg----aaa--tgattttaa---ctta--gcataatgcagaa-g----aacttttt-----------
                     BlueWhale  tgtta----aca--tttttttgg---ctta--ataaagtggaaaa-aaa-taaactcta-----------
       CommonBottlenoseDolphin  tgtta----acatttttttttgg---ctta--ataaagtgg-aaa-aaa-taaactcta-----------
                   BelugaWhale  tgtta----aca-ttttttttgg---ctta--ataaagtggaaaa-aaa-taaactcta-----------
                           Pig  tgtta----aaa---ccttttgg---ttta--ataaagcagaaaa-aaa-taaactcta-----------
                FloridaManatee  tgttg----aaa--ttattttga---cttagcataatgcagaa--------gaacttta-----------
           GreaterHorseshoeBat  tgttg----aaa---ttttctgg---ctaa--ataaagcagaaaaca-a-caaacttta-----------
       WesternEuropeanHedgehog  tgttg----aaa---tttcat--------a--atactgcagaaaa-a-g-caaatgct------------
                    HouseMouse  ttttatattgaa---aaatgttggttccac--ataaagtaaaaaa-a--------tatt-----------
              ChineseTreeShrew  tgttg----aaa---tttttttggcttaac--ataaagcagaaag-a----aaacttta-----------
                        Alpaca  tggta----aaa-ttttttttgg---ctta--atagggcaggaaa-a----aaacctct-----------
             WildBactrianCamel  tgtta----aaa-ttttttttgg---ctta--atagggcaggaaa-a----aaacctct-----------
                  ArabianCamel  tgtta----aaa-ttttttttgg---ctta--atagggcaggaaa-a----aaacctct-----------
                           Dog  tgttg----aga---ttttttag---ttta--aataagcaaaaaa-a-a-caaacttga-----------
                    MinkeWhale  tgtta----aca---ttttttgg---ctta--ataaagtggaaaa-aaa-taaactcta-----------
                   KillerWhale  tgtta----aca-ttttttttgg---ctta--ataaagtggaaaa-aaa-taaactcta-----------
                    SpermWhale  tgtta----aca--tttttttgg---ctta--ataaagtggaaaa-aaa-taaactcta-----------
                ChacoanPeccary  tgtta----aaa---ccttttgg---ttta--ataaagcagaaaa-aaa-taaactcta-----------

     Oar_rambouillet_v1_0_addY  -------------------------------------aaagttataatt-aaaataaaatgcttttactt
                        Rabbit  tttatctctgtctttcaaataaaatgaaaaaatgtaaagcatcataatg-aaagtaaaatactttcattt
                         Horse  -------------------------------------aaaattataatt-aaaatacaatgcttttattt
               ChinesePangolin  -------------------------------------aaacttatactt-aa-----aaagcttttattt
                         Human  -------------------------------------aaaattataatt-aa-----atg--ttttattc
                      Aardvark  -----------------------------------aaaaaattaaaata-aa-----aag--cttttttt
                     BlueWhale  -------------------------------------aaaattataatt-gaaataaaatgcttttaatt
       CommonBottlenoseDolphin  -------------------------------------aaaattataatt-gaaataaaatgcttttaatt
                   BelugaWhale  -------------------------------------aaaattataatt-gaaataaaatgcttttaatt
                           Pig  -------------------------------------aaaatcataattaaaaatgaaatgcttttattt
                FloridaManatee  -------------------------------------aaaatcacaact--aaattaaatgtttttatct
           GreaterHorseshoeBat  -------------------------------------aaaattataatt-aaaatgaaatgcttttattt
       WesternEuropeanHedgehog  -------------------------------------aaaatgatcatt-aaaataaaatgctttcagtt
                    HouseMouse  -------------------------------------aaaattctaatt-aaaata-----ccctt----
              ChineseTreeShrew  -------------------------------------aaaattataagc-aaagca-----cttttactt
                        Alpaca  -------------------------------------aaaattataatt-aaaataaaaaactttaattt
             WildBactrianCamel  -------------------------------------aaaattataatt-aaaataaaaaacttttattt
                  ArabianCamel  -------------------------------------aaaattataatt-aaaataaaaaacttttattt
                           Dog  -------------------------------------aaaattatgatt-aaaataaaatgctttt-tta
                    MinkeWhale  -------------------------------------aaaattataatt-gaaataaaatgcttttaatt
                   KillerWhale  -------------------------------------aaaattataatt-gaaataaaatgcttttaatt
                    SpermWhale  -------------------------------------aaaattataatt-gaaataaaatgcttttaatt
                ChacoanPeccary  -------------------------------------aaaatcataattaaaaatgaaatgcttttattt

     Oar_rambouillet_v1_0_addY  a--------tagaaattaactagat------atatgtttaggtttatatactattaaatatactatattt
                        Rabbit  g--------tagcaattaactaattagt---ata-----aaaattatattataataaatatattatattt
                         Horse  a--------tagcaatt----aagtaca---aaatgtttaggcttatattttattaaatataccatattc
               ChinesePangolin  a--------tagcaattaacaaagtata---acattactaggcttatattttgttaaataggctgtattt
                         Human  a--------gagaaatt----aagagtg---atatttataggcttatactttattaaa-----tatattt
                      Aardvark  atctgtagtgactaact----gagtatg---atctgtttaggcttatactttattaaatatgctatattt
                     BlueWhale  a--------tagcaactaactaaataca---atatgtttagacgtatatgctattaaatatactatactt
       CommonBottlenoseDolphin  a--------tagcaactaactaaataca---atatgtttagacttatatgctattacatatagtatattt
                   BelugaWhale  a--------tagcaactaactaaataca---atatgtttagacttatatgctatta-----catatattt
                           Pig  a--------tagcaattaac----taca---acatgtttagacttacatactattaaatataatatattt
                FloridaManatee  a--------tagcaattaactgagtatg---atacgtctaggcttatattttattaaatgtgttgtattt
           GreaterHorseshoeBat  a--------tagcaattaactaagtaca---atatgtttaggcttatattttattaaatacactacattt
       WesternEuropeanHedgehog  a--------cagtaatggagtaagt------atatatttagctttaaattttattatgtgcttcagattt
                    HouseMouse  -------------------------------atatgtataga--tatacttgattaaatatattatactc
              ChineseTreeShrew  a--------tggcaattaactaataagtctgatatgtatgggcctatactttattaaatgtattatattt
                        Alpaca  a--------tagcaattaac----tata---atatgtttaggcttatatattattaaatata---tattt
             WildBactrianCamel  a--------tagcaattaac----tata---atatgtttaggcttatatattattaaatata---tattt
                  ArabianCamel  a--------tagcaattaac----tata---atatgtttaggcttatatattattaaatata---tattt
                           Dog  a--------tggcagttagc----tatg---gtacttttaggcttacatcttactaaatatac--cactt
                    MinkeWhale  a--------tagcaactaactaaataca---atatgtttagatgtatatgctattaaatatactatattt
                   KillerWhale  a--------tagcaactaactaaataca---atatgtttagacttatatgctattacatatagtatattt
                    SpermWhale  a--------tatcaactaactaaataca---atatgtttagacttatatgctattacacatactatattt
                ChacoanPeccary  a--------tagcaattaac----taca---ctatgtttagact-------tattaaatataatatattt

     Oar_rambouillet_v1_0_addY  aaga-t-ctctcatgataaa---------tatgttc
                        Rabbit  aagg-t-ccctaatggtaag---------catgttc
                         Horse  aagg-t-ccctcatgataaatatgttcattatgttc
               ChinesePangolin  aagg-c-ccctaatgataaa---------tatgttc
                         Human  aagg-t-ttctcaagataaa---------tatgttc
                      Aardvark  aagg-t-ccctaaagataaa---------tatactc
                     BlueWhale  aaga-t-ccctcaagataa-----------atgttc
       CommonBottlenoseDolphin  aaga-t-ccctcaagataa-----------atgttc
                   BelugaWhale  aaga-t-ccctcaagataa-----------atgttc
                           Pig  aaga-tcccctcatgataaa---------tatgttc
                FloridaManatee  aaga-t-ccctcatgataaa---------tatactc
           GreaterHorseshoeBat  aagg-t-ctctcattataaa---------tatgttc
       WesternEuropeanHedgehog  aagg-c-ctctcatcataaa---------tatatta
                    HouseMouse  aaca-c-tt---ctagtaaa---------tatgttc
              ChineseTreeShrew  gagg-c-ttctcctgataaa---------tatgttc
                        Alpaca  aaaa-t-ctctcatgataaa---------tatgttc
             WildBactrianCamel  aaga-t-ctctcatgataaa---------tatgttc
                  ArabianCamel  aaga-t-ctctcatgataaa---------tatgttc
                           Dog  aagg-t-cccgcatgataaa---------tatgttt
                    MinkeWhale  aaga-t-ccctcaagataa-----------atgttc
                   KillerWhale  aaga-t-ccctcaagataa-----------atgttc
                    SpermWhale  aaga-t-ccctcaagataa-----------atgttc
                ChacoanPeccary  atgacc-ccctcatgataaa---------tatgttc

Alignment block 53 of 177 in window, 129062399 - 129062483, 85 bps 
B D  Oar_rambouillet_v1_0_addY  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                 JavaMouseDeer  agagcagtggaaaatcactaccaatttcctctgctcataagccagacaaaggcacc-----tt-aaccca
                         Bongo  ataggagtgaaaaataactacccgtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                         Saiga  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                         Gayal  atagtagtgagaaataactaccagtttcctgtgcttataagc----caaaggtgcc-----tt-acccca
                    LesserKudu  ataggagtgaaaaataactacccgtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                     Sitatunga  ataggagtgaaaaataactacccgtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                 MountainNyala  ataggagtgaaaaataactacccgtttcctgtgcttatgagccagacaaaggtacc-----tt-acccca
               LesserMouseDeer  agagcagtggaaaatcactaccaatttcctctgctcataagccagacaaaggcacc-----tt-aaccca
                WesternRoeDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                          Gaur  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                 AmericanBison  atagtagtgagaaataactaccagtttcctgtgcttataagc----caaaggtgcc-----tt-acccca
                       WildYak  atagtagtgagaaataactaccagtttcctgtgcttataagc----caaaggtgcc-----tt-acccca
                   DomesticYak  atagtagtgagaaataactaccagtttcctgtgcttataagc----caaaggtgcc-----tt-acccca
                  WaterBuffalo  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                AfricanBuffalo  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                   CommonEland  ataggagtgaaaaataactacccgtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                   GreaterKudu  ataggagtgaaaaataactacccgtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                      Bushbuck  ataggagtgaaaaataactacccgtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                        Impala  atagtagtgaaaaataactaccagtttcctgtgctcataagccagacaaaggtacc-----tt-accccg
                          Suni  atagtagtgaaaaataattaccagtttcctgtggttataagccagacaaaggtgcc-----tt-accccg
                  Klipspringer  acagtagtgaaaaataactactagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                 RoyalAntelope  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                   KirksDikDik  atagtggtaaaaaataactaccagtttcctgtgcttataagccagacaaaggcacc-----tt-accccg
                      Steenbok  atagtagtgaaaaataactatcagtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
            PrzewalskisGazelle  atagtagtggaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                         Oribi  atagtattgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
               ThomsonsGazelle  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                 GrantsGazelle  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                       Gerenuk  atagtagtgaaaaataactaccagtttcctgtgcttataagccaggcaaaggtacc-----tt-accttg
                     Springbok  atagtagtggaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                MaxwellsDuiker  atagtagtgaaaaatagctaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                 HarveysDuiker  atagtagtgaaaaataactaccggtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                  CommonDuiker  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                 BohorReedbuck  atagtggtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
              DefassaWaterbuck  atagtggtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accctg
                        Lechwe  agagtggtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                       Gemsbok  atagtagtgaaaaataactaccagtttcctgtgcttagaagccagacaaaggtacc-----tt-accccg
            ScimitarHornedOryx  atagtagtgaaaaataactaccagtttcctgtgcttagaagccagacaaaggtacc-----tt-accccg
                  RoanAntelope  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----ttaaccccg
                 SableAntelope  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accctg
                BlueWildebeest  atagcagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                          Topi  atagcagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                        Herola  atagcagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
               TibetanAntelope  acagtagtgaaaaataactaccggtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                  MountainGoat  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
               EuropeanMouflon  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                AsiaticMouflon  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                     SnowSheep  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                  BighornSheep  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                  BarbarySheep  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaagggacc-----tt-accccg
                        Bharal  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                   NilgiriTahr  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
B D                       ARS1  atagtagtgaaaaataatt-ccagtttcctgtgcttataagccagacagaggtacc-----tt-accccg
                      WildGoat  atagtagtgaaaaataatt-ccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
                  SiberianIbex  atagtagtgaaaaataact-ccagtttcctgtgcttataagccagacaaaggtacc-----tt-accccg
         ChineseForestMuskDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacctaccttt-acccca
                  BlackMuntjac  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                 IndianMuntjac  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                 ReevesMuntjac  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                PereDavidsDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
               WhiteLippedDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                   YarkandDeer  acagtagtgaaaaataactaccggtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                       RedDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                       HogDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
               WhiteTailedDeer  acagtagtgaaaaatgactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                      MuleDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                      Reindeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                EasternRoeDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                   EurasianElk  acagtagtgaaaaataactaccagtttcctgtgcttatacgccagacaaaggtgcc-----tt-acccca
              ChineseWaterDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtgcc-----tt-acccca
                       Giraffe  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacc-----tt-acccca
                     Pronghorn  atagtagtgaagaataactaccaatttcctgcgcttataagccagacaaaggtacc-----tt-acccca
                        Cattle  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggcacc-----tt-acccca
                    ZebuCattle  atagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggcacc-----tt-acccca
              SiberianMuskDeer  acagtagtgaaaaataactaccagtttcctgtgcttataagccagacaaaggtacctaccttt-acccca

     Oar_rambouillet_v1_0_addY  atggtagccctgtacccaata
                 JavaMouseDeer  atggtagccctgtacccaata
                         Bongo  gtggtagccctgtacccaata
                         Saiga  atggtagccctgtacccaata
                         Gayal  gtggtagccctgtacccaata
                    LesserKudu  gtggtagccctgtacccaata
                     Sitatunga  gtggtagccctgtacccaata
                 MountainNyala  gtggtagccctgtacccaata
               LesserMouseDeer  atggtagccctgtacccaata
                WesternRoeDeer  atggtagtcctgtacccaata
                          Gaur  gtggtagccctgtacccaata
                 AmericanBison  gtggtagccctgtacccaata
                       WildYak  gtggtagccctgtacccaata
                   DomesticYak  gtggtagccctgtacccaata
                  WaterBuffalo  gtggtagccctgtacccaaca
                AfricanBuffalo  gtggtagccctgtacccaaca
                   CommonEland  gtggtagccctgtacccaata
                   GreaterKudu  gtggtagccctgtacccaata
                      Bushbuck  gtggtagccctgtacccaata
                        Impala  atggtagccctgtacccgatg
                          Suni  atggtagccctgtacccaata
                  Klipspringer  atggtagccctgtacccaata
                 RoyalAntelope  atggtagccctgtacccagta
                   KirksDikDik  atggcagccctgtacccaata
                      Steenbok  atggtagccctgtacccaata
            PrzewalskisGazelle  atggtagccctgtacccagta
                         Oribi  atggtagtcctgtacccaata
               ThomsonsGazelle  atggtagccctctacccaata
                 GrantsGazelle  atggtagccctgtacccaata
                       Gerenuk  atggtagccctgtacccaata
                     Springbok  atggtagccctgtacccaata
                MaxwellsDuiker  atggtagccctgtacccaata
                 HarveysDuiker  atggtagccctgtacccaata
                  CommonDuiker  atggtagccctgtacccaata
                 BohorReedbuck  atggtagccctgtacccaata
              DefassaWaterbuck  atggtagccctgtacccaata
                        Lechwe  atggtagccctgtacccaata
                       Gemsbok  atggtagccctgtacccaata
            ScimitarHornedOryx  atggtagccctgtacccaata
                  RoanAntelope  atggtagccctgtacccaata
                 SableAntelope  atggtagccctgtacccaata
                BlueWildebeest  atggtagccctgtacccaata
                          Topi  atggtagccctgtacccaata
                        Herola  atggtagccctgtacccaata
               TibetanAntelope  atggtagccctgtacccaata
                  MountainGoat  atggtagccctgtacccaata
               EuropeanMouflon  atggtagccctgtacccaata
                AsiaticMouflon  atggtagccctgtacccaata
                     SnowSheep  atggtagccctgtacccaata
                  BighornSheep  atggtagccctgtacccaata
                  BarbarySheep  atggtagccctgtacccaata
                        Bharal  atggtagccctgtacccaata
                   NilgiriTahr  atggtagccctgtacccaata
                          ARS1  atggtagccctgtacccaata
                      WildGoat  atggtagccctgtacccaata
                  SiberianIbex  atggtagccctgtacccaata
         ChineseForestMuskDeer  atggtagccctgtacccaata
                  BlackMuntjac  atggtagctctgaacccaata
                 IndianMuntjac  atggtagccctgaacccaata
                 ReevesMuntjac  atggtagccctgaacccaata
                PereDavidsDeer  gtggtagccctgtacccaata
               WhiteLippedDeer  gtggtagccctgtacccaata
                   YarkandDeer  gtggtagccctgtacccaata
                       RedDeer  gtggtagccctgtacccaata
                       HogDeer  atggtagccctgtacccaata
               WhiteTailedDeer  atggtagccctgtacccaata
                      MuleDeer  atggtagccctgtacccaata
                      Reindeer  atggtagccctgtacccaata
                EasternRoeDeer  gtggtagtcctgtacccaata
                   EurasianElk  atggtagccctgtacccaata
              ChineseWaterDeer  atggttgtcctgtacccaata
                       Giraffe  atggtagccctgtacacaata
                     Pronghorn  atggtagccctgtacccaata
                        Cattle  gtggtagccctgtactcaata
                    ZebuCattle  gtggtagccctgtactcaata
              SiberianMuskDeer  atggtagccctgtacccaata

Alignment block 54 of 177 in window, 129062484 - 129062505, 22 bps 
B D  Oar_rambouillet_v1_0_addY  aaa-------------------------------------------------------------------
                 JavaMouseDeer  aaa-------------------------------------------------------------------
                         Bongo  aaa-------------------------------------------------------------------
                         Saiga  aaa-------------------------------------------------------------------
                         Gayal  aaa-------------------------------------------------------------------
                    LesserKudu  aaagtaggtgtcctatttcacatcctatgaaacactctcngacccccagtatcaccactgtctcttatac
                     Sitatunga  aaa-------------------------------------------------------------------
               LesserMouseDeer  aaa-------------------------------------------------------------------
                WesternRoeDeer  aaa-------------------------------------------------------------------
                          Gaur  aaa-------------------------------------------------------------------
                 AmericanBison  aaa-------------------------------------------------------------------
                       WildYak  aaa-------------------------------------------------------------------
                   DomesticYak  aaa-------------------------------------------------------------------
                  WaterBuffalo  aaa-------------------------------------------------------------------
                AfricanBuffalo  aaa-------------------------------------------------------------------
                   CommonEland  aaa-------------------------------------------------------------------
                   GreaterKudu  aaa-------------------------------------------------------------------
                      Bushbuck  aaa-------------------------------------------------------------------
                        Impala  aaa-------------------------------------------------------------------
                          Suni  aaa-------------------------------------------------------------------
                  Klipspringer  aaa-------------------------------------------------------------------
                 RoyalAntelope  aaa-------------------------------------------------------------------
                   KirksDikDik  aaa-------------------------------------------------------------------
                      Steenbok  aaa-------------------------------------------------------------------
            PrzewalskisGazelle  aaa-------------------------------------------------------------------
                         Oribi  aaa-------------------------------------------------------------------
               ThomsonsGazelle  aaa-------------------------------------------------------------------
                 GrantsGazelle  aaa-------------------------------------------------------------------
                       Gerenuk  aaa-------------------------------------------------------------------
                     Springbok  aac-------------------------------------------------------------------
                MaxwellsDuiker  aaa-------------------------------------------------------------------
                 HarveysDuiker  aaa-------------------------------------------------------------------
                  CommonDuiker  aaa-------------------------------------------------------------------
                 BohorReedbuck  aaa-------------------------------------------------------------------
              DefassaWaterbuck  aaa-------------------------------------------------------------------
                        Lechwe  aaa-------------------------------------------------------------------
                       Gemsbok  aaa-------------------------------------------------------------------
            ScimitarHornedOryx  aaa-------------------------------------------------------------------
                  RoanAntelope  aaa-------------------------------------------------------------------
                 SableAntelope  aaa-------------------------------------------------------------------
                BlueWildebeest  aaa-------------------------------------------------------------------
                          Topi  aaa-------------------------------------------------------------------
                        Herola  aaa-------------------------------------------------------------------
               TibetanAntelope  aaa-------------------------------------------------------------------
                  MountainGoat  aaa-------------------------------------------------------------------
               EuropeanMouflon  aaa-------------------------------------------------------------------
                AsiaticMouflon  aaa-------------------------------------------------------------------
                     SnowSheep  aaa-------------------------------------------------------------------
                  BighornSheep  aaa-------------------------------------------------------------------
                  BarbarySheep  aaa-------------------------------------------------------------------
                        Bharal  aaa-------------------------------------------------------------------
                   NilgiriTahr  aaa-------------------------------------------------------------------
B D                       ARS1  aaa-------------------------------------------------------------------
                      WildGoat  aaa-------------------------------------------------------------------
                  SiberianIbex  aaa-------------------------------------------------------------------
         ChineseForestMuskDeer  aaa-------------------------------------------------------------------
                  BlackMuntjac  aaa-------------------------------------------------------------------
                 IndianMuntjac  aaa-------------------------------------------------------------------
                 ReevesMuntjac  aaa-------------------------------------------------------------------
                PereDavidsDeer  aaa-------------------------------------------------------------------
               WhiteLippedDeer  aaa-------------------------------------------------------------------
                   YarkandDeer  aaa-------------------------------------------------------------------
                       RedDeer  aaa-------------------------------------------------------------------
                       HogDeer  aaa-------------------------------------------------------------------
               WhiteTailedDeer  aaa-------------------------------------------------------------------
                      MuleDeer  aaa-------------------------------------------------------------------
                      Reindeer  aaa-------------------------------------------------------------------
                EasternRoeDeer  aaa-------------------------------------------------------------------
                   EurasianElk  aaa-------------------------------------------------------------------
              ChineseWaterDeer  aaa-------------------------------------------------------------------
                       Giraffe  aaa-------------------------------------------------------------------
                     Pronghorn  aaa-------------------------------------------------------------------
                        Cattle  aaa-------------------------------------------------------------------
                    ZebuCattle  aaa-------------------------------------------------------------------
              SiberianMuskDeer  aaa-------------------------------------------------------------------

     Oar_rambouillet_v1_0_addY  ----------------------------------------------------------------------
                 JavaMouseDeer  ----------------------------------------------------------------------
                         Bongo  ----------------------------------------------------------------------
                         Saiga  ----------------------------------------------------------------------
                         Gayal  ----------------------------------------------------------------------
                    LesserKudu  acatctagatgtgtataagagacaggcttataagccagacaaaggtaccttaccccagtggtagccctgt
                     Sitatunga  ----------------------------------------------------------------------
               LesserMouseDeer  ----------------------------------------------------------------------
                WesternRoeDeer  ----------------------------------------------------------------------
                          Gaur  ----------------------------------------------------------------------
                 AmericanBison  ----------------------------------------------------------------------
                       WildYak  ----------------------------------------------------------------------
                   DomesticYak  ----------------------------------------------------------------------
                  WaterBuffalo  ----------------------------------------------------------------------
                AfricanBuffalo  ----------------------------------------------------------------------
                   CommonEland  ----------------------------------------------------------------------
                   GreaterKudu  ----------------------------------------------------------------------
                      Bushbuck  ----------------------------------------------------------------------
                        Impala  ----------------------------------------------------------------------
                          Suni  ----------------------------------------------------------------------
                  Klipspringer  ----------------------------------------------------------------------
                 RoyalAntelope  ----------------------------------------------------------------------
                   KirksDikDik  ----------------------------------------------------------------------
                      Steenbok  ----------------------------------------------------------------------
            PrzewalskisGazelle  ----------------------------------------------------------------------
                         Oribi  ----------------------------------------------------------------------
               ThomsonsGazelle  ----------------------------------------------------------------------
                 GrantsGazelle  ----------------------------------------------------------------------
                       Gerenuk  ----------------------------------------------------------------------
                     Springbok  ----------------------------------------------------------------------
                MaxwellsDuiker  ----------------------------------------------------------------------
                 HarveysDuiker  ----------------------------------------------------------------------
                  CommonDuiker  ----------------------------------------------------------------------
                 BohorReedbuck  ----------------------------------------------------------------------
              DefassaWaterbuck  ----------------------------------------------------------------------
                        Lechwe  ----------------------------------------------------------------------
                       Gemsbok  ----------------------------------------------------------------------
            ScimitarHornedOryx  ----------------------------------------------------------------------
                  RoanAntelope  ----------------------------------------------------------------------
                 SableAntelope  ----------------------------------------------------------------------
                BlueWildebeest  ----------------------------------------------------------------------
                          Topi  ----------------------------------------------------------------------
                        Herola  ----------------------------------------------------------------------
               TibetanAntelope  ----------------------------------------------------------------------
                  MountainGoat  ----------------------------------------------------------------------
               EuropeanMouflon  ----------------------------------------------------------------------
                AsiaticMouflon  ----------------------------------------------------------------------
                     SnowSheep  ----------------------------------------------------------------------
                  BighornSheep  ----------------------------------------------------------------------
                  BarbarySheep  ----------------------------------------------------------------------
                        Bharal  ----------------------------------------------------------------------
                   NilgiriTahr  ----------------------------------------------------------------------
                          ARS1  ----------------------------------------------------------------------
                      WildGoat  ----------------------------------------------------------------------
                  SiberianIbex  ----------------------------------------------------------------------
         ChineseForestMuskDeer  ----------------------------------------------------------------------
                  BlackMuntjac  ----------------------------------------------------------------------
                 IndianMuntjac  ----------------------------------------------------------------------
                 ReevesMuntjac  ----------------------------------------------------------------------
                PereDavidsDeer  ----------------------------------------------------------------------
               WhiteLippedDeer  ----------------------------------------------------------------------
                   YarkandDeer  ----------------------------------------------------------------------
                       RedDeer  ----------------------------------------------------------------------
                       HogDeer  ----------------------------------------------------------------------
               WhiteTailedDeer  ----------------------------------------------------------------------
                      MuleDeer  ----------------------------------------------------------------------
                      Reindeer  ----------------------------------------------------------------------
                EasternRoeDeer  ----------------------------------------------------------------------
                   EurasianElk  ----------------------------------------------------------------------
              ChineseWaterDeer  ----------------------------------------------------------------------
                       Giraffe  ----------------------------------------------------------------------
                     Pronghorn  ----------------------------------------------------------------------
                        Cattle  ----------------------------------------------------------------------
                    ZebuCattle  ----------------------------------------------------------------------
              SiberianMuskDeer  ----------------------------------------------------------------------

     Oar_rambouillet_v1_0_addY  -----------gtaggtgtcccatttcaca
                 JavaMouseDeer  -----------gtgggtgtccagtttcaca
                         Bongo  -----------gtaggtgtcctatttcaca
                         Saiga  -----------gtaggtgtcccatttcaca
                         Gayal  -----------gtaggtgtcccatttcaca
                    LesserKudu  acccaataaaagtaggtgtcctatttcaca
                     Sitatunga  -----------gtaggtgtcctatttcaca
               LesserMouseDeer  -----------gtgggtgtccagtttcaca
                WesternRoeDeer  -----------gtaggtgtccagtttcaca
                          Gaur  -----------gtaggtgtcccatttcaca
                 AmericanBison  -----------gtaggtgtcccatttcaca
                       WildYak  -----------gtaggtgtcccatttcaca
                   DomesticYak  -----------gtaggtgtcccatttcaca
                  WaterBuffalo  -----------gtaggtgttccatttcaca
                AfricanBuffalo  -----------gtagatgtcccatttcaca
                   CommonEland  -----------gtaggtgtcctatttcaca
                   GreaterKudu  -----------gtaggtgtcctatttcaca
                      Bushbuck  -----------gtaggtgtcctatttcaca
                        Impala  -----------gta-gtgtcccgtttcaca
                          Suni  -----------gtaggtgtcccgtttctca
                  Klipspringer  -----------gtaggtgtcccatttcaca
                 RoyalAntelope  -----------gtaggtgtcccgtttcaca
                   KirksDikDik  -----------gtaagtgtcccatttcaca
                      Steenbok  -----------gtaggtgtcccatttcaca
            PrzewalskisGazelle  -----------gtaggtgtcccatttcaca
                         Oribi  -----------gtaggtgtcccatttcaca
               ThomsonsGazelle  -----------gtaggtgtcccatttcaca
                 GrantsGazelle  -----------gtaggtgtcccatttcaca
                       Gerenuk  -----------gtaggtgtcccatttcaca
                     Springbok  -----------gtaggtgtcccatttcaca
                MaxwellsDuiker  -----------gtaggtgtcccgtttcaca
                 HarveysDuiker  -----------gtaggtgtcccgtttcaca
                  CommonDuiker  -----------gtaggtgtcccgtttcaca
                 BohorReedbuck  -----------gtaggtgtcccgtttcaca
              DefassaWaterbuck  -----------gtaggtgtcccgtttcaca
                        Lechwe  -----------gtaggtgtcccgtttcaca
                       Gemsbok  -----------gtaggtgtcccgtttcaca
            ScimitarHornedOryx  -----------gtaggtgtcccgtttcaca
                  RoanAntelope  -----------gtaggtgtcccgtttcaca
                 SableAntelope  -----------gtaggtgtcccgtttcaca
                BlueWildebeest  -----------gtaggtgtcccgtttcaca
                          Topi  -----------gtaggtgtcccgtttcaca
                        Herola  -----------gtaggtgtcccgtttcaca
               TibetanAntelope  -----------gtaggtgtcctgtttcaca
                  MountainGoat  -----------gtaggtgtcccgtttcaca
               EuropeanMouflon  -----------gtaggtgtcccatttcaca
                AsiaticMouflon  -----------gtaggtgtcccatttcaca
                     SnowSheep  -----------gtaggtgtcccgtttcaca
                  BighornSheep  -----------gtaggtgtcccgtttcaca
                  BarbarySheep  -----------gtaggtgtcccgtttcaca
                        Bharal  -----------gtaggtgtcccgtttcaca
                   NilgiriTahr  -----------gtaggtgtcctgtttcaca
                          ARS1  -----------gtaggtgtcccgtttcaca
                      WildGoat  -----------gtaggtgtcccgtttcaca
                  SiberianIbex  -----------gtaggtgtcccgtttcaca
         ChineseForestMuskDeer  -----------gtaggtgtcccatttctca
                  BlackMuntjac  -----------gtaggtgtccagtttcaca
                 IndianMuntjac  -----------gtaggtgtccagtttcaca
                 ReevesMuntjac  -----------ataggtgtccagtttcaca
                PereDavidsDeer  -----------gtaggtgtccagtttcaca
               WhiteLippedDeer  -----------gtaggtgtccagtttcaca
                   YarkandDeer  -----------gtaggtgtccagtttcaca
                       RedDeer  -----------gtaggtgtccagtttcaca
                       HogDeer  -----------gtaggtgtccagtttcaca
               WhiteTailedDeer  -----------gtaggtgtccagtttcaca
                      MuleDeer  -----------gtaggtgtccagtttcaca
                      Reindeer  -----------gtaggtgtccagtttcaca
                EasternRoeDeer  -----------gtaggtgtccagtttcaca
                   EurasianElk  -----------gtaggtgtccagtttcaca
              ChineseWaterDeer  -----------gcaggtgtccagtttcaca
                       Giraffe  -----------gtaggtgtccagtttcaca
                     Pronghorn  -----------gtaggtgtccagtttcaca
                        Cattle  -----------gtaggtgtcccatttcaca
                    ZebuCattle  -----------gtaggtgtcccatttcaca
              SiberianMuskDeer  -----------gtaggtgtcccatttctca

Alignment block 55 of 177 in window, 129062506 - 129062554, 49 bps 
B D  Oar_rambouillet_v1_0_addY  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                 JavaMouseDeer  tcctgtgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaagg
                         Bongo  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                         Saiga  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttagaag
                         Gayal  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
                    LesserKudu  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                     Sitatunga  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                WesternRoeDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaatg
                          Gaur  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
                 AmericanBison  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
                       WildYak  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
                   DomesticYak  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
                  WaterBuffalo  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                AfricanBuffalo  tcctatgaaatactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                   CommonEland  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                   GreaterKudu  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                      Bushbuck  tcctatgaaacactctcttcatac-t--ttta----------ctttgcatgaggatttaaaag
                        Impala  tcctatgaaacactctcttgatactt--ttta----------ctttgcatgaggatttaaaag
                          Suni  tcctatgaaacactctcttgacac-t--ttta----------ctttgcatgaggatttaaaag
                  Klipspringer  tcctaggaaa-actctcttgatga-ggatttaaaagaaaaatccttgcatgaggatttaaaag
                 RoyalAntelope  tcctatgaaa-actctcttgatac-t--ctta----------ctttgcatgaggatttaaaag
                   KirksDikDik  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                      Steenbok  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
            PrzewalskisGazelle  tcccatgaac-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                         Oribi  tcctatgaaa-a--ctcttgatct-t--ttta----------ctttgcatgaggatttaaaag
               ThomsonsGazelle  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                 GrantsGazelle  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                       Gerenuk  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                     Springbok  tcctgtgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                MaxwellsDuiker  tcctatgaaa-actttcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                 HarveysDuiker  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  CommonDuiker  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                 BohorReedbuck  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
              DefassaWaterbuck  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                        Lechwe  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                       Gemsbok  tcctatgaaa-actctcttgatac-g--ttta----------ctttgcatgaggatttaaaag
            ScimitarHornedOryx  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  RoanAntelope  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                 SableAntelope  tcctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                BlueWildebeest  tcctatgaaa-tctctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                          Topi  tcctatgaaa-tctctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                        Herola  tcctatgaaa-tctctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
               TibetanAntelope  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  MountainGoat  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
               EuropeanMouflon  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                AsiaticMouflon  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                     SnowSheep  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  BighornSheep  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  BarbarySheep  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                        Bharal  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                   NilgiriTahr  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
B D                       ARS1  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                      WildGoat  ccctatgaaa-actctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  SiberianIbex  ccctatgaaa-actatcttgacac-t--ttta----------ctttgcatgaggatttaaaag
         ChineseForestMuskDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                  BlackMuntjac  t-ctatgaaacactgtcttgatac-t--ttta----------ctttgtgtgaggatttaaaag
                 IndianMuntjac  t-ctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaaag
                 ReevesMuntjac  t-ctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaaag
                PereDavidsDeer  tcctatgaaacactctcttgatactt--ttta----------ctttgtgtgaggatttaaaag
               WhiteLippedDeer  tcctatgaaacactctgttgatactt--ttta----------ctttgtgtgaggatttaaaag
                   YarkandDeer  tcctatgaaacactctgttgatactt--ttta----------ctttgtgtgaggatttaaaag
                       RedDeer  tcctatgaaacactctgttgatactt--ttta----------ctttgtgtgatgatttaaaag
                       HogDeer  tcctatgaaacactctctggatactt--ttta----------ctttgtgtgaggatttaaaag
               WhiteTailedDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaa--
                      MuleDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaaa-
                      Reindeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaaa-
                EasternRoeDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaatg
                   EurasianElk  tcctatgaaaca--ctcttgatac-t--ttta----------ctttgcgtgaggatttaaaag
              ChineseWaterDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgtgtgaggatttaaatg
                       Giraffe  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag
                     Pronghorn  tcctatgaaacactctcttgatac-t--ctta----------ctttgcatgagga-ttaaaag
                        Cattle  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
                    ZebuCattle  tcctatgaaacactctcttgatac-t--ttga----------ctttgcatgaggatttaaaag
              SiberianMuskDeer  tcctatgaaacactctcttgatac-t--ttta----------ctttgcatgaggatttaaaag

Alignment block 56 of 177 in window, 129062555 - 129062569, 15 bps 
B D  Oar_rambouillet_v1_0_addY  aaaaaaagttatacc
                 JavaMouseDeer  aaaaaaagttatacc
                         Bongo  aaaaaaagttatacc
                         Saiga  aaataaagttatacc
                         Gayal  aaaaaaagttatacc
                    LesserKudu  -aaaaaagttatacc
                     Sitatunga  aaaaaaagttatacc
                 MountainNyala  aaaaaaagttatacc
                WesternRoeDeer  -aaaaaaggtatacc
                          Gaur  aaaaaaagttatacc
                 AmericanBison  aaaaaaagttatacc
                       WildYak  aaaaaaagttatacc
                   DomesticYak  -aaaaaagttatacc
                  WaterBuffalo  aaaaaaagttatacc
                AfricanBuffalo  -aaaaaagttatacc
                   CommonEland  aaaaaaagttatacc
                   GreaterKudu  aaaaaaagttatacc
                      Bushbuck  aaaagaagttatacc
                        Impala  aaaaaaagttacacc
                          Suni  aaaaaaagttatacc
                  Klipspringer  aaaaaaagttatacc
                 RoyalAntelope  aaaaaaagttctacc
                   KirksDikDik  aaaaaatgttatacc
                      Steenbok  aaaaaaagttatacc
            PrzewalskisGazelle  -aaaaaagttatacc
                         Oribi  aaaaaaagttata-c
               ThomsonsGazelle  aaaaaaagttatacc
                 GrantsGazelle  aaaaaaagttatacc
                       Gerenuk  aaaaaaa-ttatacc
                     Springbok  aaaaaaagttatacc
                MaxwellsDuiker  aaaaaaagttatacc
                 HarveysDuiker  aaaaaaagttatacc
                  CommonDuiker  aaaaaaagttatacc
                 BohorReedbuck  aaaaaaaggtatacc
              DefassaWaterbuck  aaaaaaagttatacc
                        Lechwe  aaaaaaagttatacc
                       Gemsbok  aaaaaaagttatacc
            ScimitarHornedOryx  aaaaaaagttatacc
                  RoanAntelope  aaaaaaagttatacc
                 SableAntelope  aaaaaaagttatacc
                BlueWildebeest  aaaaaaagttatacc
                          Topi  aaaaaaagttatacc
                        Herola  aaaaaaagttatacc
               TibetanAntelope  aaaaaaagttatacc
                  MountainGoat  aaaaaaagttatacc
               EuropeanMouflon  aaaaaaagttatacc
                AsiaticMouflon  aaaaaaagttatacc
                     SnowSheep  aaaaaaagttatacc
                  BighornSheep  aaaaaaagttatacc
                  BarbarySheep  aaaaaaagttatacc
                        Bharal  aaaaaaagttatacc
                   NilgiriTahr  aaaaaaagttatacc
B D                       ARS1  aaaaaaagttatacc
                      WildGoat  aaaaaaagttatacc
                  SiberianIbex  aaaaaaagttatacc
         ChineseForestMuskDeer  aaaaaaaggtatacc
                  BlackMuntjac  aaaaaaaggtatacc
                 IndianMuntjac  aaaaaaaggtatgcc
                 ReevesMuntjac  aaaaaaaggtatacc
                PereDavidsDeer  aaaaaaaggtatacc
               WhiteLippedDeer  aaaaaaaggtatacc
                   YarkandDeer  aaaaaaaggtatacc
                       RedDeer  aaaaaaaggtatacc
                       HogDeer  aaaaaaaggtatacc
               WhiteTailedDeer  aaaaaaaggtatacc
                      MuleDeer  -aaaaaaggtatacc
                      Reindeer  -aaaaaaggtatacc
                EasternRoeDeer  -aaaaaaggtatacc
                   EurasianElk  aaaaaaaggtatacc
              ChineseWaterDeer  aaaaaaaggtatacc
                       Giraffe  aaaaaaagttatgca
                     Pronghorn  aaaaaaagttataca
                        Cattle  aaaaaaagttatacc
                    ZebuCattle  aaaaaaagttatacc
              SiberianMuskDeer  aaaaaaaggtatacc

Alignment block 57 of 177 in window, 129062570 - 129062681, 112 bps 
B D  Oar_rambouillet_v1_0_addY  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                 JavaMouseDeer  atggtccttaatgttttagggaattcttttgaattgagaatgaaaattgtgtgctacatgtgtgcttcat
                         Bongo  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                         Saiga  atggtccttaaatttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                         Gayal  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccat
                    LesserKudu  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccat
                     Sitatunga  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                 MountainNyala  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                WesternRoeDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                          Gaur  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccat
                 AmericanBison  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccat
                       WildYak  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccat
                   DomesticYak  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccat
                  WaterBuffalo  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                AfricanBuffalo  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                   CommonEland  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                   GreaterKudu  atggtccttaagtttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                      Bushbuck  atggtccttaagtttttagggaattcttatgaattgagaatgaaatata--------aaatgctttccat
                        Impala  atggtccttaagtttttagggaattcttttgaactgaaattgaaatata--------aaatgctttccat
                          Suni  acagtccttaagtttttagagaattcttttgaattgaaattgaaataga--------aaatgctttccat
                  Klipspringer  atggtccttaagtttttagggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                 RoyalAntelope  atggtctttaagtttttagggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                   KirksDikDik  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                      Steenbok  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
            PrzewalskisGazelle  atggtccttaagcttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                         Oribi  atggtccttaagtttttaaggaattcttttg------aattgaaatata--------aaatgctttccat
               ThomsonsGazelle  atggtccttaaatttttaaggaattcttttgaattgaaattgaaataga--------aaatgctttccat
                 GrantsGazelle  atggtccttaaatttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                       Gerenuk  atggtccttaaatttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                     Springbok  atggtccttaaatttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                 HarveysDuiker  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgcttttcat
                  CommonDuiker  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgcttttcat
                 BohorReedbuck  atggtccttaagtttttagggaattcttttgaattgaaattgaaatata--------aaatgctttccat
              DefassaWaterbuck  atggtccttaagtttttagggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                        Lechwe  atggtccttaagtttttagggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                       Gemsbok  atggtccttaagtttttaaggaattcttttgaattgaaactgaaatata--------aaatgctttccat
            ScimitarHornedOryx  atggtccttaagtttttaaggaattcttttgaattgaaactgaaatata--------aaatgctttccat
                  RoanAntelope  atggtccttaagtttttaaggaattcttttgaattgaaactgaaatata--------aaatgctttccat
                 SableAntelope  atggtccttaagtttttaaggaattcttttgaattgaaactgaaatata--------aaatgctttccat
                BlueWildebeest  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgcttttcat
                          Topi  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgcttttcat
                        Herola  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgcttttcat
               TibetanAntelope  acggtccttaagtttttaaggaattcttttgaactgaaattgaaatata--------aaatgctttccat
                  MountainGoat  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
               EuropeanMouflon  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                AsiaticMouflon  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                     SnowSheep  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                  BighornSheep  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                  BarbarySheep  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                        Bharal  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                   NilgiriTahr  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
B D                       ARS1  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                      WildGoat  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
                  SiberianIbex  atggtccttaagtttttaaggaattcttttgaattgaaattgaaatata--------aaatgctttccat
         ChineseForestMuskDeer  atggtccttaatatttcagggaattattttgcattgagaatgaaatata--------aaatgctttccat
                  BlackMuntjac  atggtccttaattttttagggaattcgtttgaattgagaatgaaatata--------aaatgatttccat
                 IndianMuntjac  atggtccttaattttttagggaattcgtttgaattgagaatgaaatata--------aaatgatttccat
                 ReevesMuntjac  atggtccttaattttttagggaattcgtttgaattgagaatgaaatata--------aaatgatttccat
                PereDavidsDeer  atggtccttaattttttagggagttcttttgaattgagaatgaaatata--------aaatgctttccat
               WhiteLippedDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                   YarkandDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                       RedDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                       HogDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
               WhiteTailedDeer  atggtccttaatgttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                      MuleDeer  gtggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                      Reindeer  atggtccttaattttttagggaattcttttgaactgagaatgaaatata--------aaatgctttccat
                EasternRoeDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                   EurasianElk  atggttcttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccac
              ChineseWaterDeer  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                       Giraffe  atggtccttaattttttagggaattcttttgaattgagactgaaatata--------aaatgctttccat
                     Pronghorn  atggtccttaattttttagggaattcttttgaattgagaatgaaatata--------aaatgctttccat
                        Cattle  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccgt
                    ZebuCattle  atggtccttaagtttttagggaattctttggaattgagaatgaaatata--------aaatgctttccgt
              SiberianMuskDeer  atggtccttaatatttcagggaattattttgcattgagaatgaaatata--------aaatgctttccat

     Oar_rambouillet_v1_0_addY  tgatgtgctacttgattatataaataaaaacaggaagtcttcacagtaga
                 JavaMouseDeer  tgatgtgctacatgattacaaaaataaaaacatgaagtcttcatagtgga
                         Bongo  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgaa
                         Saiga  tgatgtgctacatgattatatacataaaaacatgaagtcttcacagtaga
                         Gayal  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                    LesserKudu  tgatgtgctacatgatcatataaataaaaacatgaagtcttcacagtgaa
                     Sitatunga  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgaa
                 MountainNyala  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgaa
                WesternRoeDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcaccttgga
                          Gaur  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                 AmericanBison  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                       WildYak  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                   DomesticYak  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                  WaterBuffalo  tgatgtgctacatgattatataaataaaaacatgcggtcttcacagtgga
                AfricanBuffalo  tgatgtgctacatgattatataaataaaaacatgaggtcttcacagtgga
                   CommonEland  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgaa
                   GreaterKudu  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgaa
                      Bushbuck  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgaa
                        Impala  tgacgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                          Suni  tgatgtgctacgtgattatataaataaaaacat---gtcttcacagtgga
                  Klipspringer  tgatgtgctacatgattatataaataaaaatatgaagtcttcacagtgga
                 RoyalAntelope  tgatgtgctacatgattatataaatgaaaacatgaagtcttcacagtgga
                   KirksDikDik  tgatgtgctacatgattatataaataaaaacataaagtcttcacagtgga
                      Steenbok  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
            PrzewalskisGazelle  tgatgtgctacatgattatataaataaaaacatgaagtcttcacaggggg
                         Oribi  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
               ThomsonsGazelle  tgatgtggta-atgattatataaataaaaacatgaagtcttcacagtaga
                 GrantsGazelle  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtaga
                       Gerenuk  tgatgtgctacatgattatataaataaaagcatgaagtcttcacagtgga
                     Springbok  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtaga
                 HarveysDuiker  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                  CommonDuiker  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                 BohorReedbuck  tgatgtgctacatgattatataaatgaaaacatgaagtcttcacagtgga
              DefassaWaterbuck  tgatgtgctacatgattatataaatgaaaacaggaagtcttcacagtgga
                        Lechwe  tgatgtgctacatgattatataaatgaaaacaggaagtcttcacagtgga
                       Gemsbok  tgatgtggtacatgattatataaataaaaacatgaagtcttcacagtgga
            ScimitarHornedOryx  tgatgtggtacatgattatataaataaaaacatgaattcttcacagtgga
                  RoanAntelope  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                 SableAntelope  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                BlueWildebeest  tgatgtgctacatgcttgtataaataaaaacatgaaatcttcacagtgga
                          Topi  tgatgtgctacatgcttgtataaataaaaacatgaaatcttcacagtgga
                        Herola  tgatgtgctacatgcttgtataaataaaaacatgaaatcttcacagtgga
               TibetanAntelope  tgatgtgctacatgattatataaatgaaaacatgaagtcttcacagtgga
                  MountainGoat  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
               EuropeanMouflon  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtaga
                AsiaticMouflon  tgatgtgctacttgattatataaataaaaacaggaagtcttcacagtaga
                     SnowSheep  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtaga
                  BighornSheep  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtaga
                  BarbarySheep  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                        Bharal  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtgga
                   NilgiriTahr  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtaga
                          ARS1  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtgga
                      WildGoat  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtgga
                  SiberianIbex  tgatgtgctacatgattatataaataaaaacaggaagtcttcacagtgga
         ChineseForestMuskDeer  tgatgtgctacatgattatataaataaaaatatgaagtcttcacagtgga
                  BlackMuntjac  tgaagtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                 IndianMuntjac  tgaagtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                 ReevesMuntjac  tgaagtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                PereDavidsDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagcgga
               WhiteLippedDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagcgga
                   YarkandDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagcgga
                       RedDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagcgga
                       HogDeer  tgatgtgctacatgagtatataaataaaaacatgaagtcttcacagcgga
               WhiteTailedDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                      MuleDeer  tgatgtgctrcatgattatataaataaaaacatgaagtcttcacagtgga
                      Reindeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                EasternRoeDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcaccgtgga
                   EurasianElk  tgatgtgctacatgactatataaataaaaacatgaagtcttcacagtgga
              ChineseWaterDeer  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                       Giraffe  tgatgtgctacatgattatacaaat-aaaacttgaagtcttcacagtgga
                     Pronghorn  tgatgtgctacatgattatgtaaataaaaacatgacgtcttcacagtgga
                        Cattle  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
                    ZebuCattle  tgatgtgctacatgattatataaataaaaacatgaagtcttcacagtgga
              SiberianMuskDeer  tgatgtgctacatgattatataaataaaaatatgaagtcttcacagtgga

Alignment block 58 of 177 in window, 129062682 - 129062709, 28 bps 
B D  Oar_rambouillet_v1_0_addY  tctagtacacactcaacaacaca--ttttt-
                 JavaMouseDeer  tctagtacatacccaacaacaca-ctttttt
                         Bongo  tctagtacacacccaacaataca--tttttt
                         Saiga  tctagtacacactcaacaacaca---ttttt
                         Gayal  tctagtacacacccaacaacaca--tttttt
                    LesserKudu  tctagtacacacccaacaataca--tttttt
                     Sitatunga  tctagtacacacccaacaataca--tttttt
                 MountainNyala  tctagtacacacccaacaataca--tttttt
                WesternRoeDeer  tctagtacacacctaacaacaca--tttttt
                          Gaur  tctagtacacacccaacaacaca--ttttt-
                 AmericanBison  tctagtacacacccaacaacaca--ttttt-
                       WildYak  tctagtacacacccaacaacaca--ttttt-
                   DomesticYak  tctagtacacacccaacaacaca--ttttt-
                  WaterBuffalo  tctagtacacacccaacaacaca--ttttc-
                AfricanBuffalo  tctagtacacacccaacaacaca--ttttc-
                   CommonEland  tctagtacacacccaacaataca--ttttt-
                   GreaterKudu  tctagtacacacccaacaataca--ttttt-
                      Bushbuck  tctagtacacacccaacaataca--ttttt-
                        Impala  tctagcacacactcaacaacaca--ttttt-
                          Suni  tctagtacacactcaacaacaca-tttttt-
                  Klipspringer  tctagtacacactgaacaacaca--ttttt-
                 RoyalAntelope  tctagtacacactcaacaacaca--ttttt-
                   KirksDikDik  tctagtacacactcaacaacaca--ttttt-
                      Steenbok  tctagtacacactcaacaacaca--ttttt-
            PrzewalskisGazelle  tctagtatacactcaacaacaca--ttttt-
                         Oribi  tctagtacacactcaacaacaca--ttttt-
               ThomsonsGazelle  tctagcacacacacaacaacaca--ttttt-
                       Gerenuk  tctagtacacactcaacaacata--ttttt-
                     Springbok  tctagtacacac---acaacaca--ttttt-
                 HarveysDuiker  tctagtacacactcaacaacaca--ttttc-
                  CommonDuiker  tctagtacacactcaacaacaca--ttttt-
                 BohorReedbuck  tctagtacacactcaacaacaca--ttttt-
              DefassaWaterbuck  tctagtacacactcaacaacata--ttttt-
                        Lechwe  tctagtacacactcaacaacata--ttttt-
                       Gemsbok  tctagtacacactcaacaacact--ttttt-
            ScimitarHornedOryx  tctagtacacactcaacaacact--ttttt-
                  RoanAntelope  tctagtacacactcaacaacaca--ttttt-
                 SableAntelope  tctagtacacactcaacaacaca--ttttt-
                BlueWildebeest  tctagtacacactcaacaacacattttttt-
                          Topi  tctagtacacactcaacaacaca--ttttt-
                        Herola  tctagtacacactcaacaacaca--ttttt-
               TibetanAntelope  tctagtacacacacaacgacaca--ttttt-
                  MountainGoat  tctagtacacactca---acaca--ttttt-
               EuropeanMouflon  tctagtacacactcaacaacaca--ttttt-
                AsiaticMouflon  tctagtacacactcaacaacaca--ttttt-
                     SnowSheep  tctagtacacactcaacaacaca--ttttt-
                  BighornSheep  tctagtacacactcaacaacaca--ttttt-
                  BarbarySheep  tctagtacacactcaacaacaca--ttttt-
                        Bharal  tctagtacacactcaacaacaca--ttttt-
                   NilgiriTahr  tctagtacacactcaacaacaca--ttttt-
B D                       ARS1  tctagcacacactcaacaacaca--ttttt-
                      WildGoat  tctagtacacactcaacaacaca--ttttt-
                  SiberianIbex  tctagtacacactcaacaacaca--ttttt-
         ChineseForestMuskDeer  tctagtacacatacaacaacaca--ttttt-
                  BlackMuntjac  tctagtacacacctaacaacaca---tttt-
                 IndianMuntjac  tctagtacacacctaacaacaca--ttttt-
                 ReevesMuntjac  tctagtacacacctaacaacaca-tttttt-
                PereDavidsDeer  tctagtacacacctaacaccaca--ttttt-
               WhiteLippedDeer  tctagtacacacctaacaacaca-tttttt-
                   YarkandDeer  tctagtacacacctaacaacaca-tttttt-
                       RedDeer  tctagtacacacctaacaacaca--ttttt-
                       HogDeer  tctagtacacacctaacaacaca--ttttt-
               WhiteTailedDeer  tctagtacacacctaacaacaca--ttttt-
                      MuleDeer  tctagtacacacctaacaacaca--ttttt-
                      Reindeer  tctagtacacacctaacaacaca--ttctt-
                EasternRoeDeer  tctagtacacacctaacaacaca--ttttt-
                   EurasianElk  tctagtacacacctaacaacaca--ttttt-
              ChineseWaterDeer  tctagtacacacctaacaacaca--ttttt-
                       Giraffe  tctagtacacacgcaacaacaca--ttttt-
                     Pronghorn  tctagtacacacccatcaacaca--tattt-
                        Cattle  tctagtactcacccaacaacaca--ttttt-
                    ZebuCattle  tctagtactcacccaacaacaca--ttttt-
              SiberianMuskDeer  tctagtacacatacaacaacaca--ttttt-

Alignment block 59 of 177 in window, 129062710 - 129062829, 120 bps 
B D  Oar_rambouillet_v1_0_addY  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                 JavaMouseDeer  tc-cctagaagactgacacatttactaatttttttgttgttgtttaataaagtggaaaaaataaactcta
                         Bongo  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                         Saiga  cc-cccaggagagtgataaatttgctaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                         Gayal  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaagcag-aaaaatgaactcta
                    LesserKudu  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                     Sitatunga  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                 MountainNyala  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                WesternRoeDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                          Gaur  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaagcag-aaaaatgaactcta
                 AmericanBison  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaagcag-aaaaatgaactcta
                       WildYak  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaagcag-aaaaatgaactcta
                   DomesticYak  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaagcag-aaaaatgaactcta
                  WaterBuffalo  cc-cccagaagagtgacaaatttgttaaaattctt----tcgcttaataaagcag-aaaaataaactcta
                AfricanBuffalo  cc-cccagaagagtgacaaatttgttaaaattctt----tcgcttaataaagcag-aaaaataaactcta
                   CommonEland  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                   GreaterKudu  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                      Bushbuck  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                        Impala  cc-cccggaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                          Suni  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaggcag-aaaaataaactcta
                  Klipspringer  cc-cccagaagaatgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaacttta
                 RoyalAntelope  cc-cccagaagagtgacagatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                   KirksDikDik  cc-cccagaagaatgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                      Steenbok  cc-cccagaagagtgacaaattcgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
            PrzewalskisGazelle  cc-cccagaagagtgacaaatttgtttaaattctt----tggcttaataaagcag-aaaaataaactcta
                         Oribi  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcaa-aaaaataaactcta
               ThomsonsGazelle  cc-cccagaagagtgacaattttgttaaaattctt----ttgcttaataaagcag-aaaaataaactctg
                       Gerenuk  tcacccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                     Springbok  tc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                 HarveysDuiker  tc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                 BohorReedbuck  cc-cccagaagagtgacaaatttgttaaaattctt----tggcttagtaaagcag-aaaaataaactcta
              DefassaWaterbuck  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                        Lechwe  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                       Gemsbok  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
            ScimitarHornedOryx  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                  RoanAntelope  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                 SableAntelope  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                BlueWildebeest  cc-cccagaaaagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                          Topi  cc-cccagaaaagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                        Herola  cc-cccagaaaagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
               TibetanAntelope  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                  MountainGoat  cc-cccagaagagtgacaaatttgttaaaattctt----ttgcttagtaaagcag-ataaataaactcta
               EuropeanMouflon  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                AsiaticMouflon  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                     SnowSheep  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                  BighornSheep  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                  BarbarySheep  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                        Bharal  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
                   NilgiriTahr  cc-cccagaagagtgaaatatttgttaaaattctt----ttgcttagtaaagcag-aaaaataaactcta
B D                       ARS1  cc-cccagaagagtgaaatatttgttaaaattcgt----ttgcttagtaaagcag-aaaaataaactctg
                      WildGoat  cc-cccagaagagtgaaatatttgttaaaattcgt----ttgcttagtaaagcag-aaaaataaactctg
                  SiberianIbex  cc-cccagaagagtgaaatatttgttaaaattcgt----ttgcttagtaaagcag-aaaaataaactctg
         ChineseForestMuskDeer  tc-cctagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                  BlackMuntjac  tc-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                 IndianMuntjac  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                 ReevesMuntjac  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                PereDavidsDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
               WhiteLippedDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                   YarkandDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                       RedDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                       HogDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-agaaataaacccta
               WhiteTailedDeer  -c-cccagaagagtgacaaatttgtttaaattctt----ttgcttaataaagcag-aaaaataaactcta
                      MuleDeer  -c-cccagaagagtgacaaatttgtttaaattctt----ttgcttaataaagcag-aaaaataaactcta
                      Reindeer  -c-cccagaagagtgacaaatttgtttaaattctt----ttgcttaataaagcag-aaaaataaactcta
                EasternRoeDeer  -c-cccagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta
                   EurasianElk  -c-cccagaagagtgacaaatttgttaaaattatt----ttgcttaataaagcag-aaaaataaactcta
              ChineseWaterDeer  -c-cccagaagagtgacaaatttgttagaattctt----ttgcttaataaagcag-aaaaataaactcta
                       Giraffe  -c-cccagaagagtgacaaatttgttaaaattttt----ttgcttaataaagcaa-aaaaataaactcta
                     Pronghorn  tc-cccagaagagtgacaaatttgttaaaattctt----ttgctcaataaagcag-aaaaataaactcta
                        Cattle  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaggcag-aaaaatgaactcta
                    ZebuCattle  cc-cccagaagagtgaccaatttgttaaaattctt----ttgcttaataaagcag-aaaaatgaactcta
              SiberianMuskDeer  tc-cctagaagagtgacaaatttgttaaaattctt----ttgcttaataaagcag-aaaaataaactcta

     Oar_rambouillet_v1_0_addY  aaagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                 JavaMouseDeer  aaaattataattaaaataaaatgcttttacttatacaaattaattaaatatatc--
                         Bongo  aaagttataatt-aaataaaatgcttttacttatagaaattaactagatatatgtt
                         Saiga  aaagttataattaaaatgaaatgcttttacttatagaaattaactagatctatgtt
                         Gayal  caagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                    LesserKudu  aaagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                     Sitatunga  aaagttataattaaaataaaatgcttttatttatagaaattaactagatatatgtt
                 MountainNyala  aaagttataatt-aaataaaatgcttttacttatagaaattaactagatatatgtt
                WesternRoeDeer  aaagttataattaaaataagatgcttttacttatagaaattaactagatatatgtt
                          Gaur  caagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                 AmericanBison  caagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                       WildYak  caagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                   DomesticYak  caagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                  WaterBuffalo  aaagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                AfricanBuffalo  aaagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                   CommonEland  aaagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                   GreaterKudu  gaagttataattaaaataaaatgcttttacttatagaaattaactagatatgtgtt
                      Bushbuck  aaagttataattaaaataaaatgcttttacttatagaaattaactagatatatgtt
                        Impala  aaagttataattaaaataaaatgcttttacttgtagaaattaactagatatatgtt
                          Suni  aaagttataattaaaataaaatgcttttactcatagaaattaactagatatatgtt
                  Klipspringer  aaagttataaataaaataaaatgcttttacttatagaaattaactagatatatgtt
                 RoyalAntelope  aaagttataattaaaataaaatgcttttacttatagaaatt-actagatatatgtt
                   KirksDikDik  aaagttataattaaaatgaaatgcttttacttatagaaattaactagatctatgtt