Alignments of Oar_v4_0 and Oori1
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1 in window, 168041743 - 168041869, 127 bps 
B D  Oar_v4_0  tgtaccacattaactcaaaatggaggataaaaatcatatgactattcaaaagatacacaaaagattttga
        Oori1  tgtaccacattaactcaaaatggaggataaaaatcatatgactattcaaaagatacacaaaagattttga

     Oar_v4_0  caaaatccagtctccacttttgataaaaactctctgaaaacagtatagagggcatat
        Oori1  caaaatccagtctccacttttgataaaaactctctgaaaacagtatagagggcatat

View table schema

Go to AlignVSOori1 track controls

Data last updated: 2018-04-22