Multiz alignments of 55 ruminants and 12 outgroup species
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 9 in window, 34827823 - 34827863, 41 bps 
B D                ARS1  tctctctcctgagctccagacccatatacccagcacttaaa
                   Ibex  tctctctcctgagctccagacccatatacccagcacttaaa
              BlueSheep  tctctctcctgagctccagacccatatacccagcacttaaa
           BarbarySheep  tctctctcctgagctccagacccatatacccagcacttaaa
                 Argali  tctctctcctgagctccagacccatatacccagcacttaaa
                  Sheep  tctctctcctgagctccagacccatatacccagcacttaaa
        TibetanAntelope  tctctctcctgagctccagacccatatacccagcacttaaa
                Gemsbok  tctctctcctgagctccagacccatatacccagcacttaaa
         BlueWildebeest  tctctctcctgagctccagacccatatacccagcacttaaa
             Hartebeest  tctctctcctgagctccagacccatatacccagcacttaaa
                   Topi  tctctctcctgagctccagacccatatacccagcacttaaa
          BohorReedbuck  tctctctcctgagctccagacccgtatacccagcacttaaa
       DefassaWaterbuck  tctctctcctgagctccagacccatatacccagcacttaaa
           Klipspringer  tctctctcctgagctccagacccatatacccagcacttaaa
          RoyalAntelope  tctctctcctgagctccagacccatatacccagcacttaaa
           HarveyDuiker  tctctctcctgagctccagacccatatacccagcacttaaa
           CommonDuiker  tctctctcctgagctccagacccatatacccagcacttaaa
         MaxwellsDuiker  tctctctcctgagctccagacccatatacccagcacttaaa
            KirksDikdik  tctctctcctgagctccagacctatatacccagcccttaaa
               Steenbok  tctctctcctgagctccagacccatacacccagcacttaaa
     PrzewalskisGazelle  tctctctcctgagctccagacccatatacccagcacttaaa
                  Oribi  tctctctcctgagctccagacccatatacccagcacttaaa
        ThomsonsGazelle  tctctctcctgagctccagacccatatacccagcacttaaa
          GrantsGazelle  tctctctcctgagctccagacccatatacccagcacttaaa
                Gerenuk  tctgtctcctgagctccagacccatatacccagcacttaaa
             Springbuck  tctctctcctgagctccagacccatatacccagcacttaaa
                   Suni  tctctctcctgagctccagacccatatacccagcatttaaa
                 Impala  tctctctcctgagctccagacccatatacccagcacttaaa
              Sitatunga  tctctctcctgagctccagacccatatacccagcacttaaa
                  Bongo  tctctctcctgagctccagacccatatacccagcacttaaa
          MountainNyala  tctctctcctgagctccagacccatatacccagcacttaaa
               Bushbuck  tctctctcctgagctccagacacatatacccagcacttaaa
            GreaterKudu  tctctctcctgagctccaaacccatatacccagcacttaaa
            CommonEland  tctctctcctgagctccagacccatatacccagcacttaaa
             LesserKudu  tctctctcctgagctccagacccatatacccagcacttaaa
         AfricanBuffalo  tctctctcctgagctccagacccatatacccagcacttaaa
                    Yak  tctctctcctgagctccagacccatatacccagcactttaa
      HimalayanMuskDeer  tctctctcctgagctccagacccgtatacccaacacttaaa
         ForestMuskDeer  tctctctcttgagctccagacccgtatacccaacacttaaa
           BlackMuntjac  tctctctcctgagctccagacccatatacccagcacttaaa
          IndianMuntjac  tctctct-ctgagctccagacccatatacccagcacttaaa
         ChineseMuntjac  tctctctcctgagctccagacccatatacccagcacttaaa
        WhiteLippedDeer  tctctctcctgagctccagacccatatacccagcacttaaa
                   Milu  tctctctcctgagctccagacccatatacccagcacttaaa
                RoeDeer  tctctctcctgagctccagacccatatacccagcacttaaa
       ChineseWaterDeer  tctctctcctgagctccagacccatatacccagcacttaaa
        WhiteTailedDeer  tctctctcctgagctccagacccatatacccagcacttaaa
               Reindeer  tctctctcctgagctccagacccatataccaagcacttaaa
                  Okapi  tctctctcctgagctccagacccatatacccagcacttaaa
                Giraffe  tctctctcctgagctccagacccatatacccagcacttaaa
              Pronghorn  tctctctcctgagctccagacccatatacccagcacttaaa
        LesserMouseDeer  tccctctcctgagctccagagccgcacacccggccctgaaa
             SpermWhale  tctctctcctgagctccaggcccatatagccaacactgaaa
             MinkeWhale  tctctctcctgagctccaggcccatatatccaacgctgaaa
                    Pig  tctctctcctgagctccagacccatatatccagcacttaaa
             Rhinoceros  tctctctcctgagctccagacccatatatccaatgcttaaa
                  Horse  tctctctcctgagctccagacccaaatacccaatgtttgaa
                 Cattle  tctctctcctgagctccagacccatatacccagcactttaa
           WaterBuffalo  tctctctcctgagctccagacccatatacccagcacttaaa

Alignment block 2 of 9 in window, 34827864 - 34827865, 2 bps 
B D                ARS1  gg
                   Ibex  gg
              BlueSheep  gg
           BarbarySheep  gg
                 Argali  gg
                  Sheep  gg
        TibetanAntelope  gg
                Gemsbok  gg
         BlueWildebeest  ta
                   Topi  ga
          BohorReedbuck  gg
       DefassaWaterbuck  gg
           Klipspringer  gg
          RoyalAntelope  gg
           HarveyDuiker  gg
           CommonDuiker  gg
         MaxwellsDuiker  gg
            KirksDikdik  gg
               Steenbok  gg
     PrzewalskisGazelle  gg
                  Oribi  gg
        ThomsonsGazelle  gg
          GrantsGazelle  gg
                Gerenuk  gg
             Springbuck  gg
                   Suni  gg
                 Impala  gg
              Sitatunga  gg
                  Bongo  gg
          MountainNyala  gg
               Bushbuck  gg
            GreaterKudu  gg
            CommonEland  gg
             LesserKudu  gg
         AfricanBuffalo  gg
                    Yak  gg
      HimalayanMuskDeer  gg
         ForestMuskDeer  gg
           BlackMuntjac  ga
          IndianMuntjac  ga
         ChineseMuntjac  ga
        WhiteLippedDeer  ga
                   Milu  ga
                RoeDeer  ga
       ChineseWaterDeer  ga
        WhiteTailedDeer  ga
               Reindeer  ga
                  Okapi  ag
                Giraffe  ag
              Pronghorn  gg
        LesserMouseDeer  gg
             SpermWhale  gg
             MinkeWhale  gg
                    Pig  gg
             Rhinoceros  gg
                  Horse  gg
                 Cattle  gg
           WaterBuffalo  gg

Alignment block 3 of 9 in window, 34827866 - 34827867, 2 bps 
B D                ARS1  at
                   Ibex  at
              BlueSheep  at
           BarbarySheep  at
                 Argali  at
                  Sheep  at
        TibetanAntelope  at
                Gemsbok  at
         BlueWildebeest  ct
             Hartebeest  at
                   Topi  at
          BohorReedbuck  at
       DefassaWaterbuck  at
           Klipspringer  at
          RoyalAntelope  at
           HarveyDuiker  at
           CommonDuiker  at
         MaxwellsDuiker  at
            KirksDikdik  at
               Steenbok  at
     PrzewalskisGazelle  at
                  Oribi  at
        ThomsonsGazelle  at
          GrantsGazelle  at
                Gerenuk  at
             Springbuck  at
                   Suni  at
                 Impala  at
              Sitatunga  at
                  Bongo  at
          MountainNyala  at
               Bushbuck  at
            GreaterKudu  at
            CommonEland  at
             LesserKudu  at
         AfricanBuffalo  at
                    Yak  at
      HimalayanMuskDeer  at
         ForestMuskDeer  at
           BlackMuntjac  at
          IndianMuntjac  at
         ChineseMuntjac  at
        WhiteLippedDeer  at
                   Milu  at
                RoeDeer  at
       ChineseWaterDeer  at
        WhiteTailedDeer  at
               Reindeer  at
                  Okapi  at
                Giraffe  at
              Pronghorn  at
        LesserMouseDeer  at
             SpermWhale  at
             MinkeWhale  at
                    Pig  aa
             Rhinoceros  at
                  Horse  at
                 Cattle  at
           WaterBuffalo  at

Alignment block 4 of 9 in window, 34827868 - 34827872, 5 bps 
B D                ARS1  atctt
                   Ibex  atctt
              BlueSheep  atctt
           BarbarySheep  atctt
                 Argali  atctt
                  Sheep  atctt
        TibetanAntelope  atctt
                Gemsbok  acctt
         BlueWildebeest  atctt
             Hartebeest  atctt
                   Topi  atctt
          BohorReedbuck  atctt
       DefassaWaterbuck  atctt
           Klipspringer  atctt
          RoyalAntelope  atctt
           HarveyDuiker  atctt
           CommonDuiker  atctt
         MaxwellsDuiker  atctt
            KirksDikdik  atctt
               Steenbok  atctt
     PrzewalskisGazelle  atctt
                  Oribi  atctt
        ThomsonsGazelle  atctt
          GrantsGazelle  ttctt
                Gerenuk  atctt
             Springbuck  atctt
                   Suni  atctt
                 Impala  atctt
                  Bongo  atctt
          MountainNyala  atctt
               Bushbuck  atctt
            GreaterKudu  atctt
            CommonEland  atctt
             LesserKudu  atctt
         AfricanBuffalo  atctt
                    Yak  atctt
      HimalayanMuskDeer  atctt
         ForestMuskDeer  atctt
           BlackMuntjac  atctt
          IndianMuntjac  atctt
         ChineseMuntjac  atctt
        WhiteLippedDeer  atctt
                   Milu  atctt
                RoeDeer  atctt
       ChineseWaterDeer  atctt
        WhiteTailedDeer  atctt
               Reindeer  atctt
                  Okapi  atctt
                Giraffe  atctt
              Pronghorn  atctt
        LesserMouseDeer  atctt
             SpermWhale  atctt
             MinkeWhale  atttt
                    Pig  atctt
             Rhinoceros  gtctt
                  Horse  atctt
                 Cattle  atctt
           WaterBuffalo  atctt

Alignment block 5 of 9 in window, 34827873 - 34827879, 7 bps 
B D                ARS1  tatccag
                   Ibex  tatccag
              BlueSheep  tatccag
           BarbarySheep  tatccag
                 Argali  tatccag
                  Sheep  tatccag
        TibetanAntelope  tatccag
                Gemsbok  tatccag
         BlueWildebeest  tatccag
             Hartebeest  tatccag
                   Topi  tatccag
          BohorReedbuck  tatccag
       DefassaWaterbuck  tatccag
           Klipspringer  tatcgag
          RoyalAntelope  catccag
           HarveyDuiker  tatccag
           CommonDuiker  tatccag
         MaxwellsDuiker  tatccag
            KirksDikdik  tatccag
               Steenbok  tatccag
     PrzewalskisGazelle  tatccag
                  Oribi  tatccag
        ThomsonsGazelle  tatccag
          GrantsGazelle  tatccag
                Gerenuk  tatccag
             Springbuck  tatccag
                   Suni  tatccag
                 Impala  tatccag
                  Bongo  tatccag
          MountainNyala  tatccag
               Bushbuck  tatccag
            GreaterKudu  tatccag
            CommonEland  tatccag
             LesserKudu  tatccag
         AfricanBuffalo  tatccag
                    Yak  tatccag
      HimalayanMuskDeer  tatccag
         ForestMuskDeer  tatccag
           BlackMuntjac  tatccag
          IndianMuntjac  tatccag
         ChineseMuntjac  tatccag
        WhiteLippedDeer  tatccag
                   Milu  tatccag
                RoeDeer  tatccaa
       ChineseWaterDeer  tatccag
        WhiteTailedDeer  tatccag
               Reindeer  tatccag
                  Okapi  tatccag
                Giraffe  tatccag
              Pronghorn  tatccag
        LesserMouseDeer  catccag
             SpermWhale  cattcag
             MinkeWhale  cattcag
                    Pig  cattcaa
                  Horse  catttag
                 Cattle  tatccag
           WaterBuffalo  tatccag

Alignment block 6 of 9 in window, 34827880 - 34827894, 15 bps 
B D                ARS1  acgcctctgaggcat
                   Ibex  acgcctctgaggcat
              BlueSheep  acgcctctgaggcat
           BarbarySheep  acgcctctgaggcat
                 Argali  acgcctctgaggcat
                  Sheep  acgcctctgaggcat
        TibetanAntelope  acgcctctgaggcat
                Gemsbok  acgcctctgaggcat
         BlueWildebeest  acgcctctgaggcat
             Hartebeest  acgcctctgaggcat
                   Topi  acgcctctgaggcat
          BohorReedbuck  acgcctctgaggcat
       DefassaWaterbuck  acgcctctgaggcat
           Klipspringer  acgcctctgaggcat
          RoyalAntelope  acgcctctgaggcat
           HarveyDuiker  acgcctctgaggcat
           CommonDuiker  acgcctctgaggcat
         MaxwellsDuiker  aagcctctgaggcat
            KirksDikdik  acgcctctgaggcat
               Steenbok  acgcctctgaggcat
     PrzewalskisGazelle  acgcctctgaggcat
                  Oribi  acgcctctgaggcat
        ThomsonsGazelle  acgcctctgaggcat
          GrantsGazelle  acgcctcggaggcat
                Gerenuk  acgcctctgaggcat
             Springbuck  acgcctctgaggcat
                   Suni  atgcctctgaggcat
                 Impala  acgcctccgaagcat
                  Bongo  acgcctctgaggcat
          MountainNyala  acgcctctgaggcat
               Bushbuck  acgcctctgaggcat
            GreaterKudu  acgcctctgaggcat
            CommonEland  acgcctctgaggcat
             LesserKudu  acgcctctgaggcat
         AfricanBuffalo  acgcctctgaggcat
                    Yak  acgcctctgaggcat
      HimalayanMuskDeer  acgcctctgaggcat
         ForestMuskDeer  acgcctctgaggcat
           BlackMuntjac  acacctctgaggcat
          IndianMuntjac  acgcctctgaggcat
         ChineseMuntjac  acgcctctgaggcat
        WhiteLippedDeer  acgcctctgaggcat
                   Milu  acgcctctgaggcat
                RoeDeer  acgcctctgaggcgt
       ChineseWaterDeer  acgcctctaaggcat
        WhiteTailedDeer  acgcctctgaggcat
               Reindeer  acgcctctgaggcat
                  Okapi  acgcctctgaggcat
                Giraffe  acgcctctgaggcat
              Pronghorn  acacctctgaggcat
             SpermWhale  atgcctctgaggcac
             MinkeWhale  atgcctctgcagcac
                    Pig  atgcctctgaggcac
                  Horse  acacctctgaggcat
                 Cattle  acgcctctgaggcat
           WaterBuffalo  acgcctgtgaggcat

Alignment block 7 of 9 in window, 34827895 - 34827904, 10 bps 
B D                ARS1  cttatattct
                   Ibex  cttatattct
              BlueSheep  cttatattct
           BarbarySheep  cttatattct
                 Argali  cttatattct
                  Sheep  cttatattct
        TibetanAntelope  cttatattct
                Gemsbok  cttatattct
         BlueWildebeest  cttatattct
             Hartebeest  cttatattct
                   Topi  cttatattct
          BohorReedbuck  cttatattct
       DefassaWaterbuck  cttatattct
           Klipspringer  cttatattct
          RoyalAntelope  cttatattct
           HarveyDuiker  cttatattct
           CommonDuiker  cttatattct
         MaxwellsDuiker  cttatattct
            KirksDikdik  cttatattct
               Steenbok  cttatattct
     PrzewalskisGazelle  cttatactct
                  Oribi  ctcatattct
        ThomsonsGazelle  cttatattct
          GrantsGazelle  cttatattct
                Gerenuk  cttatattct
             Springbuck  cttatattct
                   Suni  cttacattct
                 Impala  cttatattct
                  Bongo  cttatattct
          MountainNyala  cttatattct
               Bushbuck  cttatattct
            GreaterKudu  cttatattct
            CommonEland  cttatattct
             LesserKudu  cttatattct
         AfricanBuffalo  cttatattct
                    Yak  cttatattct
      HimalayanMuskDeer  cttatattct
         ForestMuskDeer  cttatattct
           BlackMuntjac  cttatatcct
          IndianMuntjac  cttatattct
         ChineseMuntjac  cttatattct
        WhiteLippedDeer  cttatattct
                   Milu  cttatattct
                RoeDeer  cttgtattct
       ChineseWaterDeer  cttatattct
        WhiteTailedDeer  cttatattct
               Reindeer  cttatattct
                  Okapi  cttatattct
                Giraffe  cttatattct
              Pronghorn  cttatattct
             SpermWhale  cttctattct
             MinkeWhale  cttatattct
                    Pig  cttgtattct
                 Cattle  cttatattct
           WaterBuffalo  cttatattct

Alignment block 8 of 9 in window, 34827905 - 34827916, 12 bps 
B D                ARS1  gtatgctcccag
                   Ibex  gtatgctcccag
              BlueSheep  gtatgctcccag
           BarbarySheep  gtatgctcccag
                 Argali  gtaagctcccag
                  Sheep  gtatgctcccag
        TibetanAntelope  gtatgctcccag
                Gemsbok  gtatgctcccag
         BlueWildebeest  gtctgctcccag
             Hartebeest  gtatgctcccag
                   Topi  gtatgctcccag
          BohorReedbuck  gtatgctcccag
       DefassaWaterbuck  gtatgctcccag
           Klipspringer  gtaggctcccag
          RoyalAntelope  gtatgctcccag
           HarveyDuiker  gtatgctcccag
           CommonDuiker  gtatgctcccag
         MaxwellsDuiker  gtatgctcccag
            KirksDikdik  ctatgctcccag
               Steenbok  gtatgctcccag
     PrzewalskisGazelle  gtatgctcccag
                  Oribi  gtatgctcccag
        ThomsonsGazelle  gtatgctcccag
          GrantsGazelle  gtatgctcccag
                Gerenuk  gtatgctcccag
             Springbuck  gtatgctcccag
                   Suni  gtatgatcccag
                 Impala  gtatgctcccag
                  Bongo  gtatgctcccag
          MountainNyala  gtatgctcccag
               Bushbuck  gtatgctcccag
            GreaterKudu  gtatgctcccag
            CommonEland  gtatgctcccag
             LesserKudu  gtatgctcccag
         AfricanBuffalo  gtatgctcccag
                    Yak  gtatgctcccag
      HimalayanMuskDeer  gtatgctcccag
         ForestMuskDeer  gtatgctcccag
           BlackMuntjac  gtatgctcccag
          IndianMuntjac  gtatgctcccag
         ChineseMuntjac  gtatgctcccag
        WhiteLippedDeer  gtgtgctcccag
                   Milu  gtatgctcccag
                RoeDeer  gtatgctcccag
       ChineseWaterDeer  gtatgctcccag
        WhiteTailedDeer  gtatgctcccag
               Reindeer  gtatgctcccag
                  Okapi  gtatgctcccag
                Giraffe  gtatgctcccag
              Pronghorn  gtatgctcccag
             SpermWhale  gtgtgcccccag
             MinkeWhale  gtatgcccccag
                 Cattle  gtatgctcccag
           WaterBuffalo  gtatgctcccag

Alignment block 9 of 9 in window, 34827917 - 34827949, 33 bps 
B D                ARS1  ctgaatcaccgtcttccatccatcccccagccc
                   Ibex  ctgaatcaccgtcttccatccatcccccagccc
              BlueSheep  ctgaatcaccgtcttccatccatcccccagccc
           BarbarySheep  ctgaatcaccgtcttccatccatcccccagccc
                 Argali  ctgaatcaccgtcttccatccatcccccagccc
                  Sheep  ctgaatcaccgtcttccatccatcccccagccc
        TibetanAntelope  ctgaatcaccgtcttccatccatcccccagccc
                Gemsbok  ctgaatcaccgtcttccatccatcccccagccc
         BlueWildebeest  ctgactcaccttctt-----------ccagccc
             Hartebeest  ctgactcaccgtcttccatccatcccccagccc
                   Topi  ctgactcaccgtcttccatccatcccccagccc
          BohorReedbuck  ctgaatcaccgtcttccatccatcccccagccc
       DefassaWaterbuck  ctgaatcaccgtcttccatccatcccccagccc
           Klipspringer  ctgaatcaccgtcttccatccatcccccagccc
          RoyalAntelope  ctgaatcaccgtcttccatccatcccccagccc
           HarveyDuiker  ctgaatcaccgtcttccatccatcccccagccc
           CommonDuiker  ctgaatcaccgtcttccatccatcccccagccc
         MaxwellsDuiker  ctgaatcaccgtcttccatccatcctccagccc
            KirksDikdik  gtgaatcactgtcttccatccatcccccagccc
               Steenbok  ctgaatcactgtcttccatccatcccccagccc
     PrzewalskisGazelle  ctgaatcactgtcttccatccgtcccccagccc
                  Oribi  ctgaatcactgtcttccatccatcccccagccc
        ThomsonsGazelle  ctgaatcactgtcttccatccatcccccagccc
          GrantsGazelle  ctgaatcactgtcttccatccatcccccagcct
                Gerenuk  ctgaatcactgtcttccatccatcccccagccc
             Springbuck  ctgaatca--gtcttccatccatcccccagccc
                   Suni  ctgaatcaccgtcttccatccatcccccagccc
                 Impala  ctgaatcactgtcttccatccatcccccagccc
                  Bongo  ctgaatcaccgtcttccatccatcccccagccc
          MountainNyala  ctgaatcaccgtcttccatccatcccccagccc
               Bushbuck  ctgaatcaccgtcttccatccatcccccagccc
            GreaterKudu  ctgaatcactgtcttccatccatcccccagccc
            CommonEland  atgaatcaccgtcttccatccatcccccagccc
             LesserKudu  ctgaatcaccgtcttccatccatcccccagccc
         AfricanBuffalo  ctgaatctccgtcttccatccatcccccagccc
                    Yak  ctgaatcaccgtcttccatccatcccccagccc
      HimalayanMuskDeer  ctgaatcactgtcttcctcccatcccccagccc
         ForestMuskDeer  ctgaatcactgtcttcctcccatcccccagccc
           BlackMuntjac  ctgaatcaccgtcttcctcccatcccccagctc
          IndianMuntjac  ctgaatcaccgtcttcctcccatcccccagccc
         ChineseMuntjac  ctgaatcaccgtcttcctcccatcccccagctc
        WhiteLippedDeer  ctgaatcaccgtcttcctcccatcccccagccc
                   Milu  ctgaatcaccgtcttcctcccatcccccagccc
                RoeDeer  ctgaatcaccgtcttcctcccatcccccagccc
       ChineseWaterDeer  ctgaatcaccgtcttcctcccatcccccagccc
        WhiteTailedDeer  ctgaatcaccgtcttcctcccatcccccagccc
               Reindeer  ctgaatcaccgtcttcctcccaccccccagccc
                  Okapi  ctgaatcaccgtcttcctcccatcccccagccc
                Giraffe  ctgaatcaccatcttcctctcatcccccagccc
              Pronghorn  ctgaatcaccttcttcctcccatcccccagccc
                 Cattle  ctgaatcaccgtcttccatccatcccccagccc
           WaterBuffalo  ctgaatcaccgtcttccatccatcccccagccc

View table schema

Go to 67-way Multiz Align track controls

Data last updated: 2019-01-31